Skip to main content

Table 4 The SSRs primer information identified for validation in this study

From: The development of SSR markers based on RNA-sequencing and its validation between and within Carex L. species

Primer #Gene_ID SSR Forward primer(5′-3′) Reverse primer(5′-3′)
CAREX001 F01.1 (AG)6 CACTGGAGAACCTAGCGACC TTGTACAAGGTCCAGGGAGAA
CAREX006 F01.141 (TC)7 CGTTCCCCGTTTTCTTCTCT GCCGTCTTCTTTGAAAACCA
CAREX008 F01.166 (TC)9 CAGTATGGTGGTGAGAGCGA CACAGACCGAACCTAACAACAA
CAREX010 F01.180 (TC)7 GCTTCGTTGTCTACTAGCCCC GACCAATCCAGCTGAGAAGC
CAREX012 F01.240 (CT)15 CCACACAGCTTATTGCTTGC TGATAGGTGGGTTTCTTGCC
CAREX015 F01.339 (AG)10 TGATTTTTCCAATGCGTGAA TGCCAGTTGAATCTCAGTGC
CAREX016 F01.3449 (AG)7 CCCCTTCAATTCAATGCTGT GCAATGAGAGGGAAAATCCA
CAREX017 F01.3529 (GA)10 TGAATCATTGAAGGAGAGAGCA GGTTGTTGCAAAGGAAGAGC
CAREX018 F01.357 (AG)7 TTTCTAACCCTTTATCGCCG AAAATTGCCTGGAGGAGGAG
CAREX019 F01.364 (AT)6 ATCATGCGGCCAAGATAAAG CAAGCAGGGGTGGAGAATAG
CAREX023 F01.463 (TC)6 TAGTGCTGCCAGAAAGAGCA AAACTCAACCCGAAAAGGCT
CAREX024 F01.501 (CT)8 GTCCCCAAAACCTCTGTAGC TGCTTGTTGTTCGCTTCATC
CAREX025 F01.5079 (AG)10 TGCATGCAGCTGGAATAGAG CTCCAAATCCGAACTATCCG
CAREX026 F01.5099 (CT)6 AGCCTCTCTCTCTCTCCGCT GCAAAAATGCCTGAGTGGAT
CAREX030 F01.608 (CT)14 CGCCTCTTCATCGATCTTTC GCCCCAATAATGGAGAGGAT
CAREX031 F01.612 (CT)9 CCCAATCTCCAAAGAGCAAA AGAACGAGACCTGGAGCTGA
CAREX037 F01.735 (AT)6 GCAGGGTTGTTGAAGGTTTG TTGTGGATGCAAAACAGCAT
CAREX040 F01.789 (TG)17 TGCTGTTCTCATGGCTTCTG CCTTTCATTTTGATGAGGCAA
CAREX041 F01.792 (AG)7 CAAAAAGGAAGCGAAAGGAA TGAGAGAGGAGATCGGAGGA
CAREX042 F01.809 (TA)8 ACAAAAGAGCTCGCTGGAAA TCTGATTGCTGCTCAACTATCTC
CAREX048 F01.1070 (GCT)5 CTTCATTTCCGCCTCTCTTG GCAATCATTATGCAATGCCA
CAREX044 F01.854 (CT)6 ACACAGGGACAAGCCGATAG CAACAAGCACAACAATAACCA
CAREX045 F01.855 (CT)6 CCAAAAGATATCATCATCTCCGA TGAGCAGCGATCTCTTTGAA
CAREX046 F01.930 (AT)6 TCTTTTTGCCAAGATGGTGA GTGCCAAGCATCAATCAGAA
CAREX050 F01.151 (CTC)6 TCATTAGCTGGTCGCTTCCT CATGCCCATTGTTCTTGATG
CAREX053 F01.3450 (CTG)5 ACCCAGTGATCGTACTTCGG AGATTCAATTTCCACCGTCG
CAREX054 F01.3506 (ACC)5 TCAACCCGCTACACCTAACC ACACGCTCCAGGTCAGAGAT
CAREX055 F01.3514 (AAC)5 CCACACCTCCTACTCCTCCA CTCCCCGTTGAAGTTGTTGT
CAREX060 F01.5072 (ATT)5 TACGCCATTGTCAACGAAAA GCACGAGACACCTGAACACA
CAREX062 F01.5103 (CAG)5 AGGCACCACAAGATCCAAAC GCTCCCATCCATACAGCTTC
CAREX064 F01.511 (CAC)9 TCCTCAGGTAGCGAAAGCAG TACCTTAATTGCGGAATCGG
CAREX069 F01.52166 (ATA)5 GTACCTGCCCTGGATTCTGA GGCGCTTTTACCAAATCAAA
CAREX070 F01.592 (ATT)6 ATTCATCAGGCAATTCTGGC GGCTAAACCAACTCCTGCAC
CAREX072 F01.675 (GAT)5 CTGATCTCAAAAGGCGAAGG CACGTAGGGATCACCCAATC
CAREX073 F01.719 (AGA)5 TAAAATGAAGGGCGAGGATG CACTCCGTGATGATGTGGTC
CAREX076 F01.785 (GAT)8 TGAAGAAGGGCCTGGTACTG AACCACCAGATCCCACAGTC
CAREX083 F01.1429 (AGA)5 GGGAATCACAGACAAAGGGA ATACTGGCAGAACCAATGGC
CAREX086 F01.11991 (CTT)6 TACGGTACAGGCGTCTCTCA CAGAAGCAACGCAACACATT
CAREX094 F01.9172 (GAAT)5 ATGGTTTCTGATTTCCTGCG GGGGTCAAATGTAGTTGCAGA
CAREX095 F01.9272 (TAAT)8 CCTTCAAAAGAGAACCGAGC TGTCGCCTTTGTGAGCATAG
CAREX096 F01.17075 (TCTCT)5 GACTCCGACTCCAGTTGAGC TCGAGGAGCTGTCCTTGAAT
CAREX097 F01.21485 (CCTCT)5 CCCATCATCGATCAATCACA GGAACAACGATCGGAAAGAA