Skip to main content

Table 5 Mutation site of three targeted mutant lines

From: Cloning of long sterile lemma (lsl2), a single recessive gene that regulates spike germination in rice (Oryza sativa L.)

Line Target type Mutation site
Line 1 gRNAs ACTGGCAGACCTTCACGCAGTTACCTCGCCGCGCACCGCCCGC (1-bp insertion)
Line 2 gRNAs ACTGGCAGACCTTCACGCAGT--CTCGCCGCGCACCGCCCGC (2-bp deletion)
Line 3 gRNAs ACTGGCAGACCTTCACGCAGT-CCTCGCCGCGCACCGCCCGC (1-bp deletion)