Skip to main content

Table 4 Indel and SSR molecular markers used for fine mapping of the lsl2 gene

From: Cloning of long sterile lemma (lsl2), a single recessive gene that regulates spike germination in rice (Oryza sativa L.)

Marker Sequence of the forward primer Sequence of the reverse primer
RM8059 GGAAAGACCAGTTTAGAGCAATGG AGCTAGATCCCTTGTTTCACACG
RM427 TCACTAGCTCTGCCCTGACC TGATGAGAGTTGGTTGCGAG
RM4098 CGTTTGGATGAAGAAGAAGA AGTGTTCGTTTCGGATTAGA
Indel7–2 CAGATATGATGTTCTTGCCCTTGC GCTTGCCAGATCACCTACCTACC
Indel7–3 CGGAGCTGTTGCCGTTCTGC CGATGTGCCATGTCAGGATGACC
Indel7–5 CCTACCGCGTCATTCACATGC GACAAGATCGACAGCCGCTACG
Indel7–6 TCACTCACACACTGACTGACACG TCTCGTCGGAGAAGAAGATGAGC
Indel7–9 CACTATGGATCTTGGTGGTCAAGG TGCTATCTGCTACCGTCAACACG
Indel7–13 GTAGGACATGAAGGCGGCTAGG ATCTCCTGCCACTGCACACC
Indel7–15 CGTCCATATCAAACCTCTTCTTCC GTAACATTCCCTCCCGAACTCC
Indel7–16 GGTGCAGACTACCTAAATATGACG GTAAACCGATGGCTTAGAGTCC
Indel7–19 AACGGGAGATCACAGGAATTTGC GTGTTCGACTCGTCTCCATTTCG
Indel7–22 ACAGTGAAAGCCACTACCAT CTTGACTGGGTGTCCATATT
Indel7–27 TAGGTGCAACTTCTTGAAGTG GATCCCCTGTTCATTTGTAATT
Indel7–30 AGGGGCGCACAGCGGGGAGGGTC TCAATCCACGGAATCCACGAC
Indel7–35 GATTTCAGAAGATGTTTGGG GGTTTCCCAGTTTCTGTCTT
Indel7–38 TGATTTTATCCTCGTCTTCC AACATGCGCATATGTAACTG
Indel7–40 TCTCTTCTCTCTTGCTTCTC ATGTCAATTTGATGGGATGT
Indel7–42 TGGAAAAGAACTTCAATGCT TTGAATCACCACAATTTAGC