Skip to main content

Table 1 Primer sequences used for real-time qRT-PCR amplification

From: The NAC-type transcription factor CaNAC46 regulates the salt and drought tolerance of transgenic Arabidopsis thaliana

Primer name Primer sequence
At-acting-F TTCCTCATGCCATCCTCCGTCTT
At-acting-R CAGCGATACCTGAGAACATAGTG
AtABI1-F GGATTTCA CCGGGATCAGATTGG
AtABI1-R GTCACCGCAGTTAGCGACG AAG
AtRD20-F TTAGCTCCGGTCACCAGTCA
AtABI1-R TGTTCCATTCGGATGCTCTG
AtP5CS1-F GTTTCCTCAGCCGCCGATTTTA
AtP5CS1-R GGAAACGCCACGTGTGGAAC
AtRD29B-F ATTCACCATCCAGAAGAAGAGCATC
AtRD29B-R ACTTCTGGGTCTTGCTCGTCA
AtPOD3-F CCAATCCGGAAACGGAAGTC
AtPOD3-R TCTGCATACTTCTTGACGAG
AtSOD4-F GAAGAACCTTGCTCCTTCCAG
AtSOD4-R GATTGGCAGTTGTGTCAACAAC
AtIAA14-F GCAGAGGAGGCAATGAGTAGTG
AtIAA14-R GAGCATCCAGTCACCATCTTTG
AtLBD18-F GTCGCTCACATCTTTGCTCTTC
AtLBD18-R AGGTAGCTCTAGTGATGCCAAATG
CaNAC46-F ATGATCAAAGGAATCGTTGGAAA
CaNAC46-R CTAAGGTTTTTGCATGTATAGGA
CaPR1-F ACTTGCAATTATGATCCACC
CaPR1-R ACTCCAGTTACTGCACCAT
CaRD22-F AGTAACTCTGGCAGTGGCAC
CaRD22-R GTAGACTGGCGGCTTTCCTT
Ca-actin-F GGTGACGAGGCTCAATCCAA
Ca-actin-R CTCTGGAGCCACACGAAGTT
CaCAT6-F TCTTGTTATTCGCGGGCCTT
CaCAT6-R TGAAGGGGACAAACCAACCC