Skip to main content

Table 1 Characteristics of 16 polymorphic microsatellite primers

From: Genetic diversity and population structure of the endangered species Paeonia decomposita endemic to China and implications for its conservation

Locus Primer sequence (5′–3′) Repeat motif Reference
50F, R F: AGAAGAGTAACATGCGCC (CT)10 [35]
R: AAGACCTCCACTGCAGAT
56A F: CAGGTGGCATTTTTGGCTTCTCTCT (AC)15 [36]
R: TTGGCCCAATCACATGTAATCCCTC
73A F: CCATCTCAGGGTCAGGGTTCTCGTA (CAG)5 [36]
R: TAGAGTGTACCTTCACCCCCATCGG
91A F: TCAGCCCCTAGCATAGAAGAATCCA (GT)9TTGTA(TG)16 [36]
R: TCTCACTACCACCTACGCGATGTTC
PAG1 F: AGTGGTGGAAGATTGGAC (AG)24 [37]
R: AAATACTCCGTCTTAGTGTGAA
AG8073 F: TCAGCTAATATGGGTGTTTC (AG)10 [37]
R: ATCAAAGTGGAAGTTCTACAGT
P03 F: ATGTCACCGAAAGTTGTGC (GA)10 [38]
R: AAAGCCTGGTGCAGTTATT
P05 F: TCGCCCAACCTGTCGTGGAGAT (AG)9 [38]
R: TTGAATAGAGCGGAATGGAAAA
P10 F: CACAAAACTCCTTCATCTTC (CT)20 [38]
R: ATCGTCAATTAGAATCAGAC
P12 F: TTGGTTGGTGAAGGTGTT (TC)9TTTCTCTCTA(TC)5 [38]
R: CTTCGATAACCGCAGGAGGAT
PSESP5 F: GCTCATTACCGCTACTACCA (A)26 [39]
R: AAAACCACTCACCTCCCA
PSMP2 F: GACTATTTTGCCCCAGACAT (ATTT)7 [40]
R: AAGATACAAGCAGTTCACGC
WD09 F: GGGGACTCAAATCCTTGCGAAAACCA (CAC)4 [41]
R: AGGCCTAGTTTTGGTCTGGGCG
Pae100 F: ACCATTCAAGGTGAGCTTCC (AT)7 [42]
R: TCCAGATATATTCCCTCACCCTA
PS004 F: GTGCTTAGCCTCTAATCTG (GA)8 [43]
R: CTTTGCTCCAAGTCTGTC
PS026 F: TTCCCTCCATTCTAACAC (AG)6 [43]
R: ACCCTAGCCTCTGACATT