Skip to main content

Table 3 List of primers used for qRT-PCR of SlGADs

From: Gamma-aminobutyric acid (GABA) alleviates salt damage in tomato by modulating Na+ uptake, the GAD gene, amino acid synthesis and reactive oxygen species metabolism

Gene name Primer name Primer sequence (5′-3′)
SlGAD1 qSlGAD1-F GGGGCGGTTCGATATTGTCT
qSlGAD1-R GCAGCACAGCAATGTGTTCA
SlGAD2 qSlGAD2-F TGTGATGAGCCCTGAGAAAG
qSlGAD2-R ATTGGAGTGTCCCACCCTGT
SlGAD3 qSlGAD3-F TGACATCGTCAAGGTCCTCC
qSlGAD3-R CAAAACTCAGCAATTGCCCT
SlGAD4 qSlGAD4-F CTCCACCTTTGCTTCTCGCT
qSlGAD4-R TCTGGCTCCATCCATGTTGT
SlACT7 qSlACT7-F ACCACCACTGCTGAACGG
qSlACT7-R ACCTCTGGGCAACGGAAC