Skip to main content

Table 2 List of primers used for Cloning of SlGADs

From: Gamma-aminobutyric acid (GABA) alleviates salt damage in tomato by modulating Na+ uptake, the GAD gene, amino acid synthesis and reactive oxygen species metabolism

Gene name Primer name Primer sequence (5′-3′)
SlGAD1 SlGAD1-F CGCTCCCGCATTTATACC
SlGAD1-R TACAGGATGGCGATGGAA
SlGAD2 SlGAD2-F CTCTTTTGCTTTACTCTTTGAT
SlGAD2-R GGTCCAATTTTACATTGTAGAT
SlGAD3 SlGAD3-F ATGGTTCTCTCAAAAA
SlGAD3-R CTTCCCTAACAAATAGATGC
SlGAD4 SlGAD4-F TTCCTCACTTTACGCCAAA
SlGAD4-R CCTTCAACAAGTAATCCTTCC