Skip to main content

Table 3 Primers used in targeted deep sequencing

From: A stable DNA-free screening system for CRISPR/RNPs-mediated gene editing in hot and sweet cultivars of Capsicum annuum

Primers Sequence
CaMLO2 F (Fig. 2a) ATGGCTAAAGAACGGTCGAT
CaMLO2 R (Fig. 2a) ATGGAGCTGGTGTATTGCAT
Primary F
for sgRNA1, sgRNA2, crRNA2
TGGGATTCATATCATTGTTGTTG
Primary R
for sgRNA1, sgRNA2, crRNA2
CCGAATGTGTCTCAGCCTTT
Primary F for crRNA1 ATGGCTAAAGAACGGTCGAT
Primary R for crRNA1 GGCACTAAGGTTGGCTACTT
Secondary F
for sgRNA1, sgRNA2, crRNA2
ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGGATTCATATCATTGTTGTTG
Secondary R
for sgRNA1, sgRNA2, crRNA2
ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGAATGTGTCTCAGCCTTT
Secondary F for crRNA1 ACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCTAAAGAACGGTCGAT
Secondary R for crRNA1 GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGCACTAAGGTTGGCTACTT
  1. The target regions of CaMLO2 edited by complexes of Cas9-sgRNA1, Cas9-sgRNA2, LbCpf1-crRNA1, or LbCpf1-crRNA2 were amplified by three consecutive PCR runs. First, the genomic region of CaMLO2 was amplified with a primer pair of CaMLO2 F and CaMLO2 R. The first PCR amplicons were used for primary PCR with primer pairs of primary F and R. The second PCR amplicons were subsequently applied by adding Illumina adaptor with primer pairs of secondary F and R. The final amplicons were subjected to bar-coding for Next Generation Sequence (NGS) analysis using Illumina Miseq