Skip to main content

Table 2 Primers used in guide-RNA synthesis

From: A stable DNA-free screening system for CRISPR/RNPs-mediated gene editing in hot and sweet cultivars of Capsicum annuum

Primers Sequence (bold: guide-RNA sequences)
sgRNA1-F GAAATTAATACGACTCACTATAGCATCTTCATCTGCCTTACAGTTTTAGAGCTAGAAATAGCAAG
sgRNA2-F GAAATTAATACGACTCACTATAGGATGACCCTTGTTTACAAAGTTTTAGAGCTAGAAATAGCAAG
sgRNA-R AAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
crRNA1-F AAGGTGATGCATAATTTGTTCAAATCTACACTTAGTAGAAATT
crRNA2-F CCAGTTTCTAACTTATGTGTCCCATCTACACTTAGTAGAAATT
crRNA-R GAAATTAATACGACTCACTATAGGGAATTTCTACTAAGTGTAGAT