Skip to main content

Table 3 Characteristics of 12 compound microsatellite loci developed for A. venetum across all the samples. Shown for each locus are the locus name, the forward (F) and reverse (R) primer sequence, allele size, repeat motif, genetic characteristics and GenBank accession number

From: De novo transcriptome assembly and population genetic analyses of an important coastal shrub, Apocynum venetum L

Locus Forward Reverse Size (bp) SSR motif NA HO HE PIC HWE GenBank accession number
Av02 AAAAATGGGCAATGGTGGGC AGGCGTAGGTGAAGAGGAGT 224 (AT)11 5 0.515 0.511 0.462 NS MT737291
Av08 AATCAGCCACCGAGTTACCG ACCTCCTGCAAGCTGAATCC 220 (CAT)6 5 0.653 0.639 0.574 NS MT737292
Av13 ACGAGAAGTTGGAAACAGACCA GTATTTGGTGTCTTCGGCGC 269 (GT)6 3 0.050 0.049 0.048 ND MT737293
Av15 ACTCGTTGGACATGATGTGCT GGACCTTCTCATCAGCCTCG 208 (CT)8 3 0.228 0.204 0.184 ND MT737294
Av21 AGCAGGGGAGAAGAATGCAC GGGTCTTGATGAGGTGAGGG 250 (ACAA)6 4 0.109 0.114 0.110 ND MT737295
Av33 CCAAACCACACAGCTCAACG CCAAACCACACAGCTCAACG 180 (AT)9 3 0.337 0.339 0.312 ND MT737296
Av39 CGCTTGCTGCCTCATCATTC CCCTCTCACACCATCCCAAC 271 (TGC)6 3 0.545 0.651 0.575 NS MT737297
Av43 CTGCATTCCCGCAAGTAACAG TGATGCAGCTTAGGAGGGTC 258 (AAG)5 2 0.356 0.294 0.250 ND MT737298
Av55 GCTCCGAGAAATCCTGCTCA GCACTGCACCCTCCTACTAC 218 (AG)9 3 0.030 0.030 0.029 ND MT737299
Av63 GGGTTTTGCTTCTGGGCATG GAGCCAATCCGAACCCCAC 157 (TC)9 2 0.327 0.301 0.254 ND MT737300
Av75 TCACTAGTACCCACCACCCC AGTGGTGGCGTTGCTATGAA 212 (GT)6(AT)6 2 0.485 0.490 0.369 NS MT737301
Av88 TGCATCATGTAGGGTACACACC GCAAGTGTTCGCTGAGTTCC 159 (AAT)7 4 0.396 0.487 0.400 NS MT737302
Mean      3.25 0.336 0.342 0.297   
  1. Notes: NA number of alleles, HO observed heterozygosity, HE expected heterozygosity, PIC polymorphism information content, HWE Hardy-Weinberg equilibrium, NS Not significant for departure from HWE, ND Not detected for departure from HWE