Fig. 4From: Transcription factor TabHLH49 positively regulates dehydrin WZY2 gene expression and enhances drought stress tolerance in wheatTabHLH49 interacts with the promoter of WZY2 (Pwzy2). a Interaction of TabHLH49 with the promoter of WZY2 in the Y1H assay. b EMSA was performed to analyze the interactions between His6-TabHLH49 and the WZY2 promoter. Increasing amounts of TabHLH49 (0.1, 0.2, 0.4, 0.6 and 0.8 μM) were used. As negative controls, bovine serum albumin (BSA) instead of His6-TabHLH49 (control A) and (GAGCGTAACTGCCCACCACTCACTGGCTCACGCGCTGCCC) repeated tandem DNA fragment instead of the WZY2 promoter (control B) were included in the binding assaysBack to article page