Skip to main content

Table 7 Primers used in the RT-PCR

From: Various effects of the expression of the xyloglucanase gene from Penicillium canescens in transgenic aspen under semi-natural conditions

Name Nucleotide sequence, 5′-3’
XEG-1 ACGGTGTTACCTGGAAGCTG
XEG-2 GACCCTGGTTTTTGATGAGG
Act-1 AAAGTGAAGATATTCAGCCTCTTGT
Act-2 GCGACCCA AATGCTAGG
UBQ-1 GGCAAGACCATAACTCTC
UBQ-2 ATCTTCTAATTGTTTACCAG
\