Skip to main content

Table 1 List of the primer used for gene expression by qRT-PCR

From: Silicon-induced thermotolerance in Solanum lycopersicum L. via activation of antioxidant system, heat shock proteins, and endogenous phytohormones

ID Forward Reversed Encoding protein Reference Accession Number
CAT GTCGATTGGTGTTGAACAGG AGGACGACAAGGATCAAACC Catalase doi:10.4236/ajps.2010.11004 M93719.1
APX GACTCTTGGAGCCCATTAGG AGGGTGAAAGGGAACATCAG cytosolic ascorbate peroxidase doi:10.4236/ajps.2010.11004 DQ099420.1
POD TTAGGGAGCAGTTTCCCACT AGGGTGAAAGGGAACATCAG peroxidase doi:10.4236/ajps.2010.11004 DQ099421.1
GR TTGGTGGAACGTGTGTTCTT TCTCATTCACTTCCCATCCA glutathione reductase doi:10.4236/ajps.2010.11004 AW033378
Cu/Zn-SOD GGCCAATCTTTGACCCTTTA AGTCCAGGAGCAAGTCCAGT SOD doi:10.3390/molecules23030535 Solyc11g066390
GST TACTCGTTTTTGGGCTCGTT CACCGATTCAACTCCCTCTG GST doi:10.1371/journal.pone.0054880 olyc01g086680
GPX ACGGAGCAAGCGACAATTGACAAC CGATTGATTCACCGCAAAGCTCGT GPX doi:10.1371/journal.pone.0054880 Solyc08g080940
NCED1 CTTATTTGGCTATCGCTGAACC CCTCCAACTTCAAACTCATTGC Synthesis of abscisic acid Nitsch et al. (2009) Z97215
ICS TGCTGCCTCATGGACATACC TGCGAATGGGGATTTTTCTT isochorismate synthase Not reported XM_019214147.2
PAL CACTTGTGAATGGCACAGCA TCCGTTCATCACTTCAGCAAA phenylalanine ammonia-lyase 1 Not reported XM_004234584.3
PR1b1 GCACTAAACCTAAAGAAAAATGGG AAGTTGGCATCCCAAGACATA Signal pathway of salicylic acid Tucci et al. (2011) Y08804
PR-P2 GGAACAGGAACACAAGAAACAGTGA CCCAATCCATTAGTGTCCAATCG Signal pathway of salicylic acid Tucci et al. (2011) X58548
HsfA1a GGGATAAATGAGGCAGCAAA TTGACCTGCAATTGCTGAAG HsfA1a doi: 10.1104/pp.15.01913. Solyc08g005170
HsfA2 CTCACCCCATTCAGGTGTTT TGCTGCAATGGACAATGAAT HsfA2 https://doi.org/10.1104/pp.15.01913 LOC101255223
SlHsfA3 AGATCCCTTGCAGGTAGCTG TGATGGCAGTATCCCAATGG Heat Stress Transcription Factor doi:10.1371/journal.pone.0054880  
HsfA7 GCTTCTTTTATCCATGGTGTCC CTTGAACCTGGAAACTCTTC Heat Stress Transcription Factor doi:10.1371/journal.pone.0054880 Solyc09g065660
HsfA1b GAAAGCTTGCACTGACGCAGG GGTCCGATATGATAGATAGTG Heat Stress Transcription Factor doi:10.1371/journal.pone.0054880 Solyc03g097120
DREB2 ATGATAATAATGTCTACAGAGCAA CTAATGTTGCCATAAAAAACTCTC dehydration responsive element binding DOI 10.1007/s13580-011-0125-5  
MAPK1 ATGCGCTTACAGAGGAACAGATG CGGACGGAATGCACACATATATAC enhanced drought tolerance https://doi.org/10.1007/s11240-017-1358-5 AJ535702