Skip to main content

Table 1 LncRNAs corresponding to miRNA precursors

From: Long non-coding RNAs in the alkaline stress response in sugar beet (Beta vulgaris L.)

lncRNA ID Class miRNA ID Mature sequence of miRNA
LNC_003498 Sense gma-miR4995 AGGCAGUGGCUUGGUUAAGGG
LNC_003048 Sense gma-miR4995 AGGCAGUGGCUUGGUUAAGGG
LNC_003418 Sense hbr-miR6173 AGCCGUAAACGAUGGAUACU