Table 5 Description of expected MTAs using imputed SNPs for agronomic traits of Iranian wheat accessions exposed to the well-watered conditions
Row | Marker | sequence | Trait | Chromosome | Position (bp) | Molecular process | Biological process |
|---|---|---|---|---|---|---|---|
1 | rs36032 | TGCAGCTCATCACTAGTCTCGCGCTCGGGCAGCAGGACCGAGCTCGTCTCGCGCCCG_25 | Grain yield and spike weight | 1A | 206,792,054-206,805,538 | nucleotide binding DNA binding damaged DNA binding ATP binding mismatched DNA binding | DNA repair pyrimidine dimer repair cellular response to DNA damage stimulus negative regulation of reciprocal meiotic recombination |
2 | rs34075 | TGCAGCGTTCGACCAGCTCATCACCCGCTTCCGAGATCGGAAGAGCGGGATCACCGACTGCCCA_19 | Leaf greenness | 1A | 60,954,701-60,956,424 | peroxidase activity oxidoreductase activity heme bindingmetal ion binding | response to oxidative stresshydrogen peroxide catabolic process oxidation-reduction process cellular oxidant detoxification |
3 | rs34314 | TGCAGCTAACTAGCCTGAGATAATGCCAGCAACTCTGCTCGGTAGCTTTCTTAAGAAGGCCTTA_45 | Spike length | 4B | 386,744,409-386,747,753 | catalytic activity tRNA-specific adenosine deaminase activity zinc ion binding hydrolase activity | tRNA modification |
4 | rs736 | TGCAGAAAGGTACCACTCATTCGTACATCACTCCAACTGATGTATGAAGGTTGTTCATGGCGAC_18 | Spike weight | 4B | 481,233,765-481,237,258 | hydrolase activity | phosphatidylinositol dephosphorylation |
5 | rs40819 | TGCAGCTTCCATTTCATTCCTTCCTGCGCCATGGGTAACAAAAATTCAACTTCTTCAGTTAACA_32 | Spike length | 4B | 667,563,369-667,564,460 | protein binding | – |
6 | rs57386 | TGCAGTATCGCAAGAGTAAAATGAAGTAGACAAAAACCTTGTATCATTAAAAGAGGCAGTCACC_18 | Days to emergence | 5A | 467,397,067-467,403,109 | serine-type endopeptidase activity serine-type peptidase activity serine-type exopeptidase activity | proteolysis |
7 | rs36808 | TGCAGCTCCGTGTCAGTGGTGTCGCGGGTGAGGCTCTTCTGCTCATCGGCGCGGATCGGAACTT_44 | Spike length | 5B | 287,752,969-287,780,293 | ATP binding ATPase activity | – |