Skip to main content

Table 1 Details of candidate reference genes and target genes used for RT-qPCR in Polygonum cuspidatum

From: Identification and evaluation of reference genes for quantitative real-time PCR analysis in Polygonum cuspidatum based on transcriptome data

GeneGene descriptionPrimer sequence (5′-3′) Forward/ReverseProduct (bp)E (%)R2NR accessionArabidopsis Ortholog
ACTactin 7F:GCCGTCTATGATTGGAATGG
R:TACCGTACAAGTCCTTCCTAA
99980.999MK288156AT5G09810
TUATubulin-alpha 6F:CCAGATGCCAAGTGACAAAAC
R:TTGTCTGTATGTTCCAGTCCT
154860.998MK288157AT4G14960
TUBTubulin-beta 2F:ATCCGACACTGTTGTTGAGC
R:CCAAAGGATGGGGTTGAAAG
144860.998MK288158AT5G23860
GAPDHGlyceraldehyde-3 phosphate dehydrogenaseF:CAGTGACTGTTTTCGGTTGC
R:AGCCTTGTCCTTGTCGGTGA
107910.999MK288159AT1G13440
EF-1γElongation factor 1-gammaF:GTCATCCCTGATTGATTACGC
R:GTGGGCAATAAAGCCAAGAC
112950.998MK288160AT1G57720
UBQUbiquitin domain-containing proteinF:AGTCCTCAACTTCGTGCTATG
R:TTCTGGAGGCACATTTGGAGT
294890.995MK288161AT2G17200
UBCUbiquitin-conjugating enzymeF:ATTTGATGGCGTGGAGTTGC
R:AGGGGTAAACATTGGGGTGG
156980.999MK288162AT3G57870
60SrRNA60S ribosomal RNAF:ACTGTGATTTCGCAGACGCA
R:CCTGGTGCTTGGTGAGACGG
124980.999MK288163AT5G02610
eIF6AEukaryotic translation initiation factor 6AF:CGGATCTTGACAGGGAAACC
R:AACGGCACCTGAAGGAGTGT
187940.997MK288164AT3G55620
SKD1Suppressor of K+ transport growth defect1F:GGCGATGGTGAGGGAGATGA
R:ACCCAGCCACATCATTCCAC
1061040.997MK288165AT2G27600
YLS8Thioredoxin-like protein YLS8F:AGATCAACTGGGCTCTAAAGG
R:AATCACCAGACCTCGACCCT
921030.998MK288166AT5G08290
NDUFA13NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 13-AF:ATGTACCAGGTCGGCGTAGG
R:TCCTTCATAATTCTGGCTTCC
161980.998MK288167AT1G04630
Target gene
PcMYB4Transcription repressor MYB4F:TTGATACCGCTACAACCACA
R:CACCCGTCACAACGCTATT
196960.994MK288154AT4G38620
PcPALPhenylalanine ammonia-lyaseF:AGAACAGGATCAAGGAAT
R:AACAAGGAATCAATCATC
158960.997MK288155AT2G37040
PcSTSStilbene synthasesF:CCAGACCTAACAGTTGAGA
R:TCGCACCATCAGATTCA
80900.997EU647245