Fig. 4

Functional validation of TaPDS gRNAs by in vitro nuclease assay. A 2.479 kb fragment of wheat TaPDS (TraesCS4B02G300100) gene was amplified using wheat (Chinese Spring) genomic DNA and the primers TaPDS_F3 (5′- cgcagaggtgtttcacaagt - 3′) and TaPDS_R4 (5′ - gagccatgcttctcctacac - 3′). a The expected band sizes of cleaved products using different guide RNAs against the 2.479 Kb input DNA. b In vitro nuclease assay of the input DNA using Cas9 and different guide RNAs. The Cas9 endonuclease (100 nM), guide RNAs (100 nM) and PCR amplified TaPDS target DNA fragment (10 nM) were mixed together at a molar ratio of 10:10:1 in a total assay reaction volume of 30 μl. The reactions were incubated at 37 °C for 30 min. The assay was stopped by the addition of Proteinase K and products were analyzed using an agarose gel electrophoresis