Skip to main content

Table 1 Synthetic DNA oligo used in this research

From: A Glycine max sodium/hydrogen exchanger enhances salt tolerance through maintaining higher Na+ efflux rate and K+/Na+ ratio in Arabidopsis

Oligo nameSequence (5`- 3`)Application
GmNHX1-FacgttgcacgggatcccccttcatgccatgggacaConstruction of TRV induced GmNHX1 silencing vector.
GmNHX1-Rctagctagggggtacctccagaggaccaacatccaac
RT GmNHX1 FactgcgaagcaatgcaatcaDetection of transcriptional level of GmNHX1 and using RT-PCR.
RT GmNHX1 Rggccattacgttcagttggtg
RT ACTIN Fatggctgatggtgaagacattc
RT ACTIN Rtccatgctcaatagggtacttg
OE GmNHX1 FggtaccatggtttttgaaatcagttcConstruction of binary vector pCAMBIA1300-GmNHX1.
OE GmNHX1 Rtctagatcaacgccattgatggcca
GFP GmNHX1 FtgcccatgggacaaaatggtttttgaaatcConstruction of GFP fused vector pCAMBIA1300-GmNHX1-GFP.
GFP GmNHX1 Rcgccccgggacgccattgatgg
qRT AtSKOR FaccgaaacaaactcggtaggaaDetection of transcriptional level of salt stress related genes using RT-qPCR.
qRT AtSKOR Rttagcacggatagagacaggaatg
qRT AtSOS1 Fgtgaagcaatcaagcggaaa
qRT AtSOS1 Rtgcgaagaaggcgtagaaca
qRT AtHKT1 Fgatttgtccccacgaatgaga
qRT AtHKT1 Rcaaaaccaagaagcaagggaac
qRT AtAKT1 Faaaggtctcactcatcaacaacga
qRT AtAKT1 Rtcggcaaaagaggcaaaataag
qRT ACTIN Fgcaccgccagagagaaaatac
qRT ACTIN Rcaccaccacgaaccagataaga