Oligo name | Sequence (5`- 3`) | Application |
---|---|---|
GmNHX1-F | acgttgcacgggatcccccttcatgccatgggaca | Construction of TRV induced GmNHX1 silencing vector. |
GmNHX1-R | ctagctagggggtacctccagaggaccaacatccaac | |
RT GmNHX1 F | actgcgaagcaatgcaatca | Detection of transcriptional level of GmNHX1 and using RT-PCR. |
RT GmNHX1 R | ggccattacgttcagttggtg | |
RT ACTIN F | atggctgatggtgaagacattc | |
RT ACTIN R | tccatgctcaatagggtacttg | |
OE GmNHX1 F | ggtaccatggtttttgaaatcagttc | Construction of binary vector pCAMBIA1300-GmNHX1. |
OE GmNHX1 R | tctagatcaacgccattgatggcca | |
GFP GmNHX1 F | tgcccatgggacaaaatggtttttgaaatc | Construction of GFP fused vector pCAMBIA1300-GmNHX1-GFP. |
GFP GmNHX1 R | cgccccgggacgccattgatgg | |
qRT AtSKOR F | accgaaacaaactcggtaggaa | Detection of transcriptional level of salt stress related genes using RT-qPCR. |
qRT AtSKOR R | ttagcacggatagagacaggaatg | |
qRT AtSOS1 F | gtgaagcaatcaagcggaaa | |
qRT AtSOS1 R | tgcgaagaaggcgtagaaca | |
qRT AtHKT1 F | gatttgtccccacgaatgaga | |
qRT AtHKT1 R | caaaaccaagaagcaagggaac | |
qRT AtAKT1 F | aaaggtctcactcatcaacaacga | |
qRT AtAKT1 R | tcggcaaaagaggcaaaataag | |
qRT ACTIN F | gcaccgccagagagaaaatac | |
qRT ACTIN R | caccaccacgaaccagataaga |