Fig. 6From: A novel miniature transposon-like element discovered in the coding sequence of a gene that encodes for 5-formyltetrahydrofolate in wheatRT-PCR analysis with primers flanking Mariam in exon 6 of TRIDC2AG023940 gene. The forward primer (AACCGCAATATGCGGATGTT) was complementary to exon 5 (upstream of Mariam insertion), and the reverse primer (TTGTCAATTGTTTGATCAAACAAAGG) was complementary to exon 7 (downstream of Mariam insertion). The RT-PCR reaction was performed in the same conditions as the site-specific PCR analysis in Fig. 1 (see Methods). The upper arrow notes a 942 bp band corresponding with Mariam insertion (in accession 13), while the lower arrow notes a 626 bp band that does not harbor Mariam insertion (in accessions 9, 15–47). M denotes the size marker (the numbers in the left are in bp), while NC denotes a negative controlBack to article page