Skip to main content

Table 1 List of SSR markers linked to repeat-fruiting in cultivated strawberry. “SS” indicates the primer sequences were used individually in sequence-similarity searches against the cultivated strawberry reference genome. “BP” means the primer pairs were used in PCR reactions with 32 breeding parents of known flowering phenotype in the USDA-ARS Beltsville strawberry breeding program

From: Evidence of epistatic suppression of repeat fruiting in cultivated strawberry

SSR name Use Primer sequences Reference
ChFaM011 SS, BP F: TCCTCTCCTTCTTTCCCTTCA Zorrilla-Fontanesi et al. 2011 [19]
   R: CGAGATCTCCCGAGACTGAG  
EMFvi136 SS F: GAGCCTGCTACGCTTTTCTATG Sargent et al. 2003 [20]
   R: CCTCTGATTCGATGATTTGCT  
F.v.D3 SS, BP F: CAGGATCGTTCTTGCTAGTG Spigler et al. 2010 [21]
   R: GTTTCTGTTTTCTGGGGTTTGAATA  
CX661225 SS F: GCTCTCCTCCTCCGTCTCTT Spigler et al. 2008 [22]
   R: GTTTAGCTTCTCCGCTGACG  
ChFaM148 SS, BP F: CCCTCCATCAAAGCCAGTT Zorrilla-Fontanesi et al. 2011 [19]
   R: CATTAGACCCCGACTTGTCA  
ChFaM148A SS F: GGTTCTGCGCCACATAGCTA Current study
   R: CGTATGAGGACGGGGAGGTA  
ChFaM148B SS F: TTGTGCTGCCCTCCATCAAA Current study
   R: TGCACTCTTCCATGGCTTCC  
ChFaM148C SS, BP F: GTAGAGATCGATGTATGGTACGT Current study
   R: GGATGTCCAATTTGGTTCTGTT  
ChFaM148D SS F: GCGACTGAGGCGTACATACT Current study
   R: CGATCAACATCTTGGCAACCC  
FxaACA02I08C SS, BP F: TAGCAGAAGCATTTCACTCCCTCC Honjo et al. 2016 [23]
   R: GAATGGCATTTGAGAAATGAGAGCA  
FANhyb19.1–15 BP F: TTCTCCATCTTCACATTTCTG Current study
   R: TGCTCTCTTTTGCTAAGTACG  
FANhyb19.1–4 BP F: GGTCTGGATTTAGGAGAGAAA Current study
   R: TCTTCTTCTTTCATCAGAAGC  
FANhyb19.1–1 BP F: GCAACTTCTCAACTTTAGCAC Current study
   R: CGTGATGAGTTCAAATTAAGG  
FANhyb19.1–6 BP F: GGTTTAGGAGAGAAACCAATC Current study
   R: GATTACACTCGCACACTTCTC  
FANhyb19.1–3 BP F: CGCAGCACCAGTCTTTCATG Current study
   R: AACCCTCCTCCTCCTCCTTC  
FxaAGA01G05C BP F: CATTTATCACTGTTTGGCGTTCCC Honjo et al. 2016 [23]
   R: CAAAACACCCACGATTATACGGGT  
FxaAGA02N04C BP F: AACAAATTTCAAACCTGAGGAGCG Honjo et al. 2016 [23]
   R: AACAGTGTTGCAGTTTCATCCGAA  
Bx056 BP F: GGTTACTGGCTCTGCTTGGA Perrotte et al. 2016 [24]
   R: CACAATTGAGATCGAGCAACA  
Bx059 BP F: GACGTTGACCATGACAGAGC Perrotte et al. 2016 [24]
   R: CCCAAAGAAAGCCCAACATA  
Bx064 BP F: GGGGAGGTGAAACTGTGAAA Perrotte et al. 2016 [24]
   R: TGCAATCTTTGGGAGAGAGAA  
Bx083 BP F: ACGTGCCTTAGCGGATCATA Perrotte et al. 2016 [24]
   R: CCTAGGTCGGGATCTCAGAA  
Bx089 BP F: CACCAAAGATGACTGCTGGA Perrotte et al. 2016 [24]
   R: TAAACAGCCCCTGAATCCAA  
Bx215 BP F: CAATTTCCCGCCAAAAGTAA Perrotte et al. 2016 [24]
   R: GTTGGAGCTTCGAGCAAGTT  
Bx250 BP F: GGCATTTCCGCAGATAAAAA Perrotte et al. 2016 [24]
   R: AACCTCCTCGTGTTTGATGC