Skip to main content

Table 4 Target proteins from iTRAQ and corresponding primers for qPCR

From: Integrative omics analysis on phytohormones involved in oil palm seed germination

Name Protein ID Primer sequences (5′-3′) Amplicon length (bp)
ABA XP_010918764.1 F- GTTTGGAGGAAGCCGATCCA
R- TGAACACCAGGTGCAACAGA
127
GA XP_010904836.1 F- CTCCTTTCGGCGAGATTGGT
R- CTCTATCTCAAGCCGGGCAC
71
ET XP_010915532.1 F- TCCCCCATCCAAAATCCAAACA
R- ATTTGTACTTCGTGCCCCCTT
113
CTK XP_010906323.1 F- TCGGCAAAAGATGCTTGGGA
R- CCAGACCCTTCTTACGCTACA
79
IAA XP_010917603.1 F- AGGAGAATGGAAGGTGGAGGA
R- CAAGCCTTAGCTCGGTTGCT
70
JA XP_010908911.1 F- AACAGGGCCTCACTCTGGTA
R- GAACCGGGCTAATGATGCCT
193