Skip to main content

Table 2 Primers used for quantitative real-time PCR

From: Genome-wide identification and characterization of long non-coding RNAs involved in fruit ripening and the climacteric in Cucumis melo

Gene ID Forward Primer Reverse Primer
LNC_000401 AGGAGCCGAATGAAACCAAAG GAACCCGCATCGTTAGCTTG
LNC_000454 GACACTGAACCACAGATTCCACA GTTTCGTGTGTTGTTGCTCTGAC
LNC_000636 CAGTGACATACGATGATGGTTGG CAGTCACATACATCATAAGTCCATCAG
LNC_000987 CATCTTTTCCTTTTCCCCTTTGT TGATTTGAGGATTCTTGTGGTGG
LNC_001286 AACTTCACATCTCTTTCATCGCA GGACAAACGCAACGTCTTCAAC
LNC_001730 CTTTCTTTACTCCTCAAACTCCG GTAGAGGATGAGTTGGCGGC
LNC_002015 GGGAAATGTGTAGAAGAAGCAGT ATCAATGGACTCTCTATCCTCTCTT
LNC_002556 TCCAAAGTCAAGAGGGAAATAGCC CTAAGCCCACCTCCTGGTTGTC
LNC_002609 GGAACCAAATAGTTGTGGATGTG ATGGTGATTGTTTGCTCCTGTC
LNC_000141 TTCCGATTAAATCCTCTTGTTTGT TTCTCGTCTCCATTCTTCGTCAC
GAPDH CGTGTTCCTACCGTTGATGTCTCT TCAGTGTACCCCAAAATTCCCTTC