Skip to main content

Table 3 The primers for qRT-PCR

From: Putative trehalose biosynthesis proteins function as differential floridoside-6-phosphate synthases to participate in the abiotic stress response in the red alga Pyropia haitanensis

Primers Sequence (5′ → 3′) Tm (°C) PCR products
PhTPS1-Q5′ AGTTTCCGTTTGTGTGGGTG 58.0 132 bp
PhTPS1-Q3′ CCGTTGTAGTAGAGGTGGGC  
PhTPS2-Q5′ TGCTGGGGGTGGAAGGG 59.0 196 bp
PhTPS2-Q3′ GGGGAAGGGGGTGTGGAG  
PhTPS3-Q5′ CTGCCCACTCGTTTTCCA 57.0 142 bp
PhTPS3-Q3′ CCGGCTCAATTTCTTCCAG  
PhTPS4-Q5′ TGTATGATGGGGACCGAACG 58.0 184 bp
PhTPS4-Q3′ GCCACGGAATGTGAAGGAAG  
Ph18S-Q5′ AGTTAGGGGATCGAAGACGA 55.0 153 bp
Ph18S-Q3′ CAGCCTTGCGACCATACTC