Skip to main content

Advertisement

Table 2 List of primers used in the study

From: Metabolic and transcriptional analyses in response to potent inhibitors establish MEP pathway as major route for camptothecin biosynthesis in Nothapodytes nimmoniana (Graham) Mabb

S.No Primer name Primer Sequence (5′-3′) Direction
1. DXPR 5’CGGTGAACTTAAGGAGGC3’ Forward
2. DXPR 5’TGGCTTCAAACCTGCACA3’ Reverse
3. DPCMEK 5’GGATGGTTTTCATGATCTGGC3’ Forward
4. DPCMEK 5’GCCTTTATGATCAAGTTTCG3’ Reverse
5. MECDPS 5’GTGCTGCTTCACTGCGTG3’ Forward
6. MECDPS 5’CTCGTGCATCAGTCGCAC3’ Reverse
7. HMBEDPR 5′ ACATGTCCATGGGTGTCT3’ Forward
8. HMBEDPR 5’CAAGTTTACCCCCAAGAATG3’ Reverse
9. HMG 5′ TTCCTTCTGCGCCTAAAATGATG3’ Forward
10. HMG 5’AATAGAGGCCGCACGAAAACAGT3’ Reverse
11. MK 5’CTTGCTGTTGGAGTTTCAG3’ Forward
12. MK 5’ATCTGACAAAGCAAGCAG3’ Reverse
13. PMK 5’GGTTGCAATGACTTCTATTC3’ Forward
14. PMK 5’AACTTCAGGCTTGCAACT3’ Reverse
15. DPMD 5’GCATGTGCATTCATTGCTTC3’ Forward
16. DPMD 5’AGAACCTTGCCTTGCTAT3’ Reverse
17. SLS 5’ATGTCCACAATCCACTGG3’ Forward
18. SLS 5’ATTTGTTCAGCAGGTCATCGT3’ Reverse
19. STR 5’CAGCAAGTGAGCGAGCACATT3’ Forward
20 STR 5’AAGAGGAATACCTTGGGCTTG3’ Reverse
21. Actin 5’ATGACATGGAGAAGATCTGGCATCA3’ Forward
22. Actin 5’AGCCTGGATGGCAACATACATAGC3’ Reverse
23. rolB 5’GCTCTTGCAGTGCTAGATTT3’ Forward
24. rolB 5’GAAGGTGCAAGCTACCTCTC3’ Reverse