Skip to main content

Table 4 Sequences and positions of the SNP markers developed for the selection of pi21

From: Improving the blast resistance of the elite rice variety Kongyu-131 by updating the pi21 locus

Markers Chr. Position (IRGSP1.0) Forward primer (5′-3′) Reverse primer (5′-3′)
SNP1 4 19,354,482 TGCACCAGTATTAACAATTGA CCATAAAACTAGATATAGAGC
SNP2 4 19,855,434 TGCTAATCCGGAATCTCGAC TTCGAACATAAGGTGGTCGAC
InDel3 4 19,856,847 GATCCTCATCGTCGACGTCT TTGCAGTCCTCCGGAGGCTTCT
SNP4 4 19,860,126 TGGGATAGTCATCAATGGTGC CCATTGATGAGTCTATTGTAG
SNP5 4 19,988,873 ATAATGGGATGAGACCCATC TGGGATCCAGATTCGTAGTCTC