Skip to main content

Advertisement

Table 2 Gene ID and gene-specific primers for qRT-PCR validation

From: A transcriptome analysis reveals a role for the indole GLS-linked auxin biosynthesis in secondary dormancy in rapeseed (Brassica napus L.)

Gene ID Forward primer Reverse primer Arabidopsis homolog
BnaA03g01690D GCAGGAGACATATTCCAGATTGTG ATCGACCAACATGATGTGCTCAG ASA1
BnaC08g25400D CCAACAACACCAACAGAGAGAATG GACTTTGTGAGACTCTCAAGCTCC TSA1
BnaA10g09090D CTCACTCCATCAGTGCAGGATTG GTTCAACACGACTCTGCTTCCG TSB1
BnaA01g34610D CTCAACGAGTGCTCCGAAGTTAC GACCATAACCAACGGTTTACACAG CYP79B2
BnaA08g04520D GAGAAACCATAGCAGACGCGAAG CTCTACCATTGCGACTCCAAGAT CYP83B1
BnaA07g31260D GTAAAGGCTTGTCTGTGTACGGTC CGTCTCTTCCACTAACCCATCG SOT16
BnaA04g17910D CCTCACACTCCACATCATGTTC TCAAGTGTCTCCTTCCAAGCAG GSTF9
BnaA07g00460D GTCGATTTGGTGTGTGATAGGC CCTCAAGCATATGAGCTTCCAC SUR1
BnaA03g57920D TGAGAGAGAGATGGGTCGTGTTC GCTTCACAATGGACTCACCAAC IGPs
BnaA02g05170D GCTGTGGATTTAGGACAGATTGAA CTGGAACAGGCAAGTCAAAGCTC AAO1
BnaC04g19270D GGAGGGATTGAGAATTTGTTGAA GCGAATCGACATCTCTATGCTC APR1
BnaC01g00790D GGTGAAGTGGCAAAGCTGTTTG GATGATGTTTTCAGCCATCTGAC APK2
BnaA03g59800D GAGGGATTGAGAATCTGTTGAAGC ATAAGCGAATCCACATCTCTATGC APR2
BnaA10g11280D GACGGTTGCTCACGAAACTCTC ACTAAGCATTGTGTTGCTCTCTCC CYP81F2
BnaA01g12900D CATCTGACGACAATATTCCCTGAG CACATGCTTCAACAAACCATCTCT GSH1
BnaC02g40130D ACGTGGTGAATTTCTTGGTCCAC GTTGACACCCTTCTCCTTGATGAC TGG2
BnaCnng66020D ACAAACGGTGGGAGTGGTAA GTGATCACCGCTCGCATATC WRKY33
BnaC04g38910D TGACGGATACAGGTGGAGGAAG GTCAAGATGTGGTGGAAGTTATCG WRKY45
BnaA05g28580D CAGTGATGAACGCAAGATCATC AAGCCTCCTCTCTCAGACACAAC SZF1
BnaAnng08970D TTCTCCAACTCGTCCAGGC GGCACTTGTCGTAGTTTCCG GASA1
BnaA09g44500D CAAGAAGATGGAGAAGTCGGCTAG CATGAGAAGATTCGAGGTTGGTG MYB51
BnaC04g38910D ACGACGGAGCACTACGTCACTATC ATCACCAGCAGTATAAGCAGAAGC Bzip44
BnaCnng74400D GTATTGGATTCAGAAGTGCCTGG TCTGTGAGATGCACAAATGCTG TRN1
BnaC01g12390D CTGATAGTCTCAACACCAAACTTCG GTCCTTCTGCTACACTCTCAACAGC HEN1
BnaC03g14590D ACGAGCTAACCGAAGCTGATG AAACATTCCAGCACCAAATGTGT FQR1
BnaA09g05810D TGCAGATGGTCTTAAGAGCTACCAG TTCCTTCTTCTCCGACTCATCTCC CNX1
BnaA09g52180D ATCCACAAGACATCATGGCTGAG CTGGTTCATCTTCAATTCCACATTC CATHB3
BnaC03g30870D GCCTTTGAAGATGGAGACCTCA TCGGTGAAGAGCTTCTTGGTG GSTF2