Skip to main content

Table 8 miRNA mature sequence and primers

From: Identification of miRNAs and their target genes in Larix olgensis and verified of differential expression miRNAs

miRNA miRNA sequence (5′-3′) length (nt) reverse primer sequence (5′-3′)
miR160 ugccuggcucccuguaugcca 21 TGCCTGGCTCCCTGTATGC
miR164 uggagaagcagggcacgugcg 21 ATGGAGAAGCAGGGCACGT
miR166–1 ucggaccaggcuucauucccc 21 TCGGACCAGGCTTCATTCC
miR166–2 aaacgcauuucguacggacuga 22 AAACGCATTTCGTACGGACTGA
miR396–1 ucccacagcuuucuugagcuu 21 TCCCACAGCTTTCTTGAGCTT
miR396–2 gaaagcuguggaagagcau 19 GGGAAAGCTGTGGAAGAGCAT
miR950–1 ucacaucugggccacgaugguu 22 TCACATCTGGGCCACGATG
miR950–2 ugacaucugggccacgaugguu 22 TGACATCTGGGCCACGATG