Skip to main content

Table 3 Allelic diversity of thirty used EST-SSR markers in ninety-five accessions of Elymus

From: EST-SSR marker development based on RNA-sequencing of E. sibiricus and its application for phylogenetic relationships analysis of seventeen Elymus species

Primer SSRs Forward primer Reverse primer Tm (°C) T M TP PP He Ho PIC
c11036 (TAG)5 CACTTGGGTGTGCAAAAGAA TTCCCCTAGCAGGCAGATTA 58 5 0 5 100.0% 0.73 0.90 0.32
c24738 (AGC)5 ATTTTGGCTATTGAGCGTGG GAAGATGGGCGACAAATTCT 58 22 0 22 100.0% 0.94 0.92 0.36
c40721 (GAG)5 GAGGGTAATGACCGTCTGGA TCTGGCCATGTTGTTGTTGT 58 21 0 21 100.0% 0.94 0.97 0.39
c40810 (ACA)6 ATCTTCTATCACGGCCAACG TTGATGGCACATTGAGATCC 58 15 0 15 100.0% 0.91 0.92 0.35
c45646 (TTG)5 CTGATGATGATGGCCAGTTG GAGAGGTCATTCCGCATGTT 60 19 0 19 100.0% 0.94 0.96 0.42
c47765 (GCT)5 GAGAGAGACACACGGAAGGC GACAGAGAGCTCGCAGGAG 62 23 0 23 100.0% 0.94 1.00 0.36
c56077 (TGA)5 GGCCAATCAAATTGGAACAT AAGGCCTCCGAGCTAAAAAG 56 13 0 13 100.0% 0.91 0.89 0.37
c57159 (TGT)5 CGCCGCTTATCACTTTTGTT ACTAATGATGTCGCCGATCC 58 21 0 21 100.0% 0.93 1.00 0.35
c60959 (ACT)5 CATTGTTGGCGTTCAATCAC CCGTTAGCTCATCCAAGCTC 58 15 0 15 100.0% 0.91 0.96 0.38
c61134 (TCC)6 CCTCCCAGGTGACACGTACT GGTAGGGGGCGTAAGAAGAG 64 11 0 11 100.0% 0.85 1.00 0.28
c62352 (CGG)6 TTTTAGAGCAGCAGCAGCAA GACCCGGAGAAGATCAACAA 58 22 0 22 100.0% 0.93 1.00 0.32
c64785 (CTT)5 TCCCTTTGTCTCCCTCTCCT ACAATCACGGCGATAAGGTC 60 18 0 18 100.0% 0.92 0.94 0.33
c65566 (CGC)5 TCCTCGTCTCCTCCCTCC CTCGTCCTCGTAGTGCTCCT 60 23 0 23 100.0% 0.95 1.00 0.41
c66150 (CGG)5 CTCAGATCGTCCTCCGTCAC CTCCTCCTGCTGCTCGTC 60 25 0 25 100.0% 0.95 1.00 0.34
c66252 (CTT)6 GGAGGAGGAGAACTTCCTGG TCACCGGAAAAACACATTCA 56 21 0 21 100.0% 0.94 1.00 0.33
c66352 (CTG)5 GACTACTGGAGGCGGACTTG GAGAGCAGGCAGAGAGCCTA 64 19 0 19 100.0% 0.93 1.00 0.31
c66859 (AAG)5 AGCGACCTGGACATGAACTC GAATCCACCCTGAAGGATCA 60 20 0 20 100.0% 0.94 0.96 0.41
c67170 (CCG)5 GGACCTCCCACAAAGTGAAA AGTAGCTCCCCACCACGAG 60 22 0 22 100.0% 0.94 0.99 0.38
c67290 (CGG)5 AGACGAGGACGTCGGTGTT AGACACGCGAGAGGGTAGAC 60 25 0 25 100.0% 0.95 1.00 0.41
c68346 (AGC)5 CGAGTTGTGTCACCCAGAGA ACAAGCAAGGCATACCCAAG 60 16 0 16 100.0% 0.92 1.00 0.37
c68713 (CGG)6 GTTCGTCGTCTCCGCATC AAGAAGCACAGGCCAAGC 56 25 0 25 100.0% 0.95 1.00 0.43
c69557 (GCG)5 ACCAGGCGATTTATGGACAG GTGACCGCAACAATGACAAC 60 19 0 19 100.0% 0.94 0.95 0.38
c69822 (GCA)5 CAGCCGAAAATTTCCGTAGA GCCATTTGAGGAGGACAAAA 58 20 0 20 100.0% 0.93 1.00 0.28
c70441 (CGG)5 TGGAGGAGACGGTAGAGGTG CAAGAATAAACGGGAGCGAA 58 21 0 21 100.0% 0.93 1.00 0.33
c70704 (AAG)5 ACCTCAACCGTGCTCTCAAG TCCTTGGCCATCAACTTCTC 60 19 0 19 100.0% 0.94 1.00 0.40
c70817 (GAC)5 AGCCATGCTCAGGACCATAC TACATTCTGCTGCTTGGCAC 60 17 0 17 100.0% 0.93 0.99 0.41
c71552 (GCC)5 CACTTCTCTCTCTCCCTCGC CCGTGGATGACAACGGTTAC 62 19 0 19 100.0% 0.93 1.00 0.36
c75219 (GGA)5 CACTCGCAACCGAGGAAG CGGAGTCCAACGTCGTCTAC 58 16 0 16 100.0% 0.92 1.00 0.38
c79438 (TAA)5 TGAATGATTCTCGCGAAGTG GAGGAGGGCAAACAACAAAA 58 20 0 20 100.0% 0.93 0.99 0.36
c82957 (GCC)6 GAGAACAACGGGCAAGAAGA GGGACGATTTGGAACAGCTA 60 20 0 20 100.0% 0.94 0.98 0.40
Mean      19.1 0 19.1 100.0% 0.92 0.98 0.36
  1. T total number of amplified bands, M number of monomorphic bands, TP total number of polymorphic bands, PP percentage of polymorphism, He expected heterozygosity, Ho observed heterozygosity, PIC polymorphic information content