Skip to main content

Table 1 The primers and PCR condition for three genes

From: Genome constitution and evolution of Elytrigia lolioides inferred from Acc1, EF-G, ITS, TrnL-F sequences and GISH

Gene Name of primers Sequences of primers (5′-3′) Profiles
Acc1 Acc1F1 CCCAATATTTATCATGAGACTTGCA 1 cycle: 5 min 94 °C; 35 cycles: 30s 94 °C, 30s 56 °C, 2 min 30s 68 °C; 1 cycle 10 min 68 °C.
Acc1F2 CAACATTTGAATGAAThCTCCACG
EF-G cMWG699T3–2 AACTGTTTTCTCATTTGTGA 1 cycle: 5 min 94 °C; 35 cycles: 30s 94 °C, 30s 55 °C, 1 min 30s 72 °C; 1 cycle 10 min 72 °C.
cMWG699T7–2 AAGTGTCCTTGCCTTCCAAA
ITS ITSL TCGTAACAAGGTTTCCGTAGGTG 1 cycle: 5 min 94 °C; 35 cycles: 30s 94 °C, 1 min 50 s 55 °C, 1 min 50 s 72 °C; 1 cycle 10 min 72 °C.
ITS4 TCCTCCGCTTATTGATATGC
TrnL-F c CGAAATCGGTAGACGCTACG 1 cycle: 5 min 94 °C; 35 cycles: 1 min 94 °C, 1 min 55 °C, 1 min 72 °C; 1 cycle 10 min 72 °C.
f ATTTGAACTGGTGACACGAG