Skip to main content

Table 2 A summary of genes description and primers sequences used for RT-qPCR

From: Decarboxylation mechanisms of C4 photosynthesis in Saccharum spp.: increased PEPCK activity under water-limiting conditions

Gene

Description

ESTs Saccharum spp.

Locus Sorghum bicolor

Primer forward (5′-3′)

Primer reverse (5′-3′)

Amplicon (bp)

Efficiency (%)

NADP-ME

NADP-malic enzyme

comp88554_c0_seq11

Sb03g003230

GTGAGGCCTGCCAGAAGTAT

CTAGGACCTTCCCCTTGTCC

84

99

NAD-ME1

NAD-malic enzyme

comp79553_c1_seq21

Sb01g017790

TACAGGGGACAGCTGGAGTT

CTCCCACAACGACGATCTTT

102

95.5

NAD-ME2

NAD-malic enzyme

comp83394_c0_seq41

Sb02g033920

CAGCAGTTCCCTGAACATCA

CGCTGGCCTAATGTTATCGT

118

92.5

PEPCK

Phosphoenol-pyruvate carboxykinase

comp81929_c0_seq51

Sb01g040720

CTGTCGCAGGAGAAAGAACC

CAGATTTGTCGGCGTAGTCA

112

100

AspAT1

Aspartate aminotransferase

comp82581_c0_seq11

Sb03g035220

GCACAGTCCTCATGCTCAAA

AATAGCGAGCAAGTGGCATT

97

93

AspAT2

Aspartate aminotransferase

comp83051_c1_seq51

Sb04g036060

CGCGTTTAACAAAGCAACAG

CCGAGAGAGACTGAATTGTAGC

94

97

AlaAT

Alanine aminotransferase

TC1135192

Sb01g023750

TGCCACAGAAAGCAATTGAG

GGACCACGACAATTCCAGTT

99

98.5

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

SCBFFL4116A05.g3

CACGGCCACTGGAAGCATCCTCAG

TCCTCAGGGTTCCTGATGCC

101

97.5

  1. 1[59]
  2. 2(ESTs obtained in ftp://occams.dfci.harvard.edu/pub/bio/tgi/data/.)
  3. 3(GenBank EST)