Skip to main content

Table 2 A summary of genes description and primers sequences used for RT-qPCR

From: Decarboxylation mechanisms of C4 photosynthesis in Saccharum spp.: increased PEPCK activity under water-limiting conditions

Gene Description ESTs Saccharum spp. Locus Sorghum bicolor Primer forward (5′-3′) Primer reverse (5′-3′) Amplicon (bp) Efficiency (%)
NADP-ME NADP-malic enzyme comp88554_c0_seq11 Sb03g003230 GTGAGGCCTGCCAGAAGTAT CTAGGACCTTCCCCTTGTCC 84 99
NAD-ME1 NAD-malic enzyme comp79553_c1_seq21 Sb01g017790 TACAGGGGACAGCTGGAGTT CTCCCACAACGACGATCTTT 102 95.5
NAD-ME2 NAD-malic enzyme comp83394_c0_seq41 Sb02g033920 CAGCAGTTCCCTGAACATCA CGCTGGCCTAATGTTATCGT 118 92.5
PEPCK Phosphoenol-pyruvate carboxykinase comp81929_c0_seq51 Sb01g040720 CTGTCGCAGGAGAAAGAACC CAGATTTGTCGGCGTAGTCA 112 100
AspAT1 Aspartate aminotransferase comp82581_c0_seq11 Sb03g035220 GCACAGTCCTCATGCTCAAA AATAGCGAGCAAGTGGCATT 97 93
AspAT2 Aspartate aminotransferase comp83051_c1_seq51 Sb04g036060 CGCGTTTAACAAAGCAACAG CCGAGAGAGACTGAATTGTAGC 94 97
AlaAT Alanine aminotransferase TC1135192 Sb01g023750 TGCCACAGAAAGCAATTGAG GGACCACGACAATTCCAGTT 99 98.5
GAPDH Glyceraldehyde-3-phosphate dehydrogenase SCBFFL4116A05.g3 CACGGCCACTGGAAGCATCCTCAG TCCTCAGGGTTCCTGATGCC 101 97.5
  1. 1[59]
  2. 2(ESTs obtained in ftp://occams.dfci.harvard.edu/pub/bio/tgi/data/.)
  3. 3(GenBank EST)