Skip to main content

Table 1 Prediction of VvmiR160 target genes by bioinformatics

From: VvmiR160s/VvARFs interaction and their spatio-temporal expression/cleavage products during GA-induced grape parthenocarpy

MiR-Acc. MiRNA mature sequence MiRNA length Target_Acc. Expectation UPE Target regions Inhibition Multiplicity
VvmiR160a/b TGCCTGGCTCCCTGAATGCCATC 23 VIT_218s0001g04180.1 (VvARF17) 1 20.766 CDS:1755–1777 Cleavage 1
23 VIT_208s0040g01810.1 (VvARF10) 1 23.188 CDS:2389–2411 Cleavage 1
23 VIT_208s0040g01810.3 (VvARF10) 1 23.188 CDS:2513–2535 Cleavage 1
23 VIT_208s0040g01810.2 (VvARF10) 1 23.188 CDS:2389–2411 Cleavage 1
23 VIT_208s0040g01810.4 (VvARF10) 1 23.188 CDS:2534–2556 Cleavage 1
23 VIT_218s0001g04180.2 (VvARF17) 1 20.766 CDS:1755–1777 Cleavage 1
23 VIT_213s0019g04380.1 (VvARF16) 1 22.721 CDS:1566–1585 Cleavage 1
23 VIT_213s0019g04380.3 (VvARF16) 1 22.721 CDS:1566–1585 Cleavage 1
23 VIT_213s0019g04380.4 (VvARF16) 1 22.721 CDS:1701–1720 Cleavage 1
23 VIT_213s0019g04380.2 (VvARF16) 1 22.721 CDS:2147–2166 Cleavage 1
VvmiR160c/d/e TGCCTGGCTCCCTGTATGCCA 21 VIT_218s0001g04180.1 (VvARF17) 0.5 20.766 CDS:1757–1777 Cleavage 1
21 VIT_208s0040g01810.1 (VvARF10) 0.5 23.188 CDS:2391–2411 Cleavage 1
21 VIT_208s0040g01810.3 (VvARF10) 0.5 23.188 CDS:2515–2535 Cleavage 1
21 VIT_208s0040g01810.2 (VvARF10) 0.5 23.188 CDS:2391–2411 Cleavage 1
21 VIT_208s0040g01810.4 (VvARF10) 0.5 23.188 CDS:2536–2556 Cleavage 1
21 VIT_218s0001g04180.2 (VvARF17) 0.5 20.766 CDS:1757–1777 Cleavage 1
21 VIT_213s0019g04380.1 (VvARF16) 0 22.721 CDS:1566–1585 Cleavage 1
21 VIT_213s0019g04380.3 (VvARF16) 0 22.721 CDS:1566–1585 Cleavage 1
21 VIT_213s0019g04380.4 (VvARF16) 0 22.721 CDS:1701–1720 Cleavage 1
21 VIT_213s0019g04380.2 (VvARF16) 0 22.721 CDS:2147–2166 Cleavage 1
  1. Note: The targeted information of VvmiR160s and VvARFs obtained by Pstarget software (http://plantgrn.noble.org/psRNATarget/#)