Skip to main content

Advertisement

Table 2 PCR primers used in the current study

From: Isolation and functional validation of the CmLOX08 promoter associated with signalling molecule and abiotic stress responses in oriental melon, Cucumis melo var. makuwa Makino

Primer name Primer sequence (5′–3′)
LOX08pro-F TAGTAGCATTGGGCACATA
LOX08pro-R TATTAGCGTCTGCGGAGA
LP1-F1 AGCTT TAGTAGCATTGGGCACATA
LP1-F2 T TAGTAGCATTGGGCACATA
LP2-F1 AGCTT GGTCTCCCCGATGCATAT
LP2-F2 T GGTCTCCCCGATGCATAT
LP3-F1 AGCTT GTATAACATCGACTTACAAATAG
LP3-F2 T GTATAACATCGACTTACAAATAG
LP4-F1 AGCTT CAAAAATTGGGTAAAAGTG
LP4-F2 T CAAAAATTGGGTAAAAGTG
LP5-F1 AGCTT CAAACTTAAAAGAAAAGCAAACAG
LP5-F2 T CAAACTTAAAAGAA AAGCAAACAG
LP-R1 C TATTAGCGTCTGCGGAGA
LP-R2 GATCC TATTAGCGTCTGCGGAGA
  1. Nucleotides underlined were used for producing HindIII and BamHI restriction site