Skip to main content

Table 2 Gene-specific primers used for amplification of the TaMyc genes in current study. Primer pairs used for promoter region amplification of TaMyc-A1 are underlined

From: Myc-like transcriptional factors in wheat: structural and functional organization of the subfamily I members

Gene Purpose Annealing temperature. (°C) PCR product length (bp) DNA/cDNA Forward primer (5′ → 3′) Reverse primer (5′ → 3′)
TaMyc-A1 qRT-PCR, sequencing 60 283/177 AACCATGTCATTTCGGAGAGGA GGCCGCCCTGTTGGATC
  PCR, sequencing 60 −/1707 ATGGCGCTGCCAGTAGTTCGTC TCATGGCCTGCGAATAGCTCTCT
  cloning 50 292/− TTATTAGATTAAGTATAGTTTTTTTGGTAGAA CAACATCAAAATACTATACTACACTAACA
  cloning 53 231/− TGTTAGTGTAGTATAGTATTTTGATGTTG ACCATAACCCATAAATAAAAAAAAAACTTCC
  cloning 57 309/− GGAYGATAGGTTGGTTTTTGAGTTTTTTG CCATTACCACACTATTTCCTTCCTTCA
TaMyc-A2 qRT-PCR, sequencing 60 334/220 AACCATGTCATTTCGGAGAGGA TCTTCCCGCCGACTTCATGA
  PCR, sequencing 60 −/1697 ATGGCGCTGCCAGTAATTCGTC TCAGCGCCTGCGTATAGCTTTCT
TaMyc-B1 qRT-PCR, sequencing 60 347/198 AACCATGTCATTTCGGAGAGGA GAGTTTTCGGACGGCTGTTG
  PCR, sequencing 60 −/1692 ATGGCGCTGTCAGTAGTTCGTC TCAGCGCCTGCGTATGGCTCT
TaMyc-D1 PCR, sequencing 60 504/244 GCTCATCGTGCTTTGCGG GCCGCCCTGTTGGATTCT
TaMyc-D2 qRT-PCR, sequencing 60 341/188 AACCATGTCATTTCGGAGAGGA ACGGCTGTTCCGGCCA
  PCR, sequencing 63 −/1665 ATGGCGCTGCCGGTAGTTCATC TCATCCGGGTTCCACGGCTCCA