Skip to main content

Table 1 DNA primers sequences for polymorphic markers designed for fine mapping of qRDWN6XB on chromosome 6

From: RDWN6XB, a major quantitative trait locus positively enhances root system architecture under nitrogen deficiency in rice

Marker Marker type Forward primer sequence Reverse primer sequence Purpose Size
RM5963 SSR TCAAGTTACGGGAAATGTGTGG CTGCCTAGCTTCCGTTTCTCC Primary mapping 139
InD90 InDel CCTCATCCAGGGGTCATGTA CGGTCAAGTGTCATCCAGGT Primary mapping 19
RM20069 SSR GCGAGCGAGAGGAGAGATAGACG CGAATTCGGCACGAGTAATAGGG Primary mapping 157
ND-3 InDel AGACGGTGATATCGGTGAGT GGAGTTTAGTGGCTGCATCA Fine mapping 258
ND-4 InDel AAAACACCAAAGAATCCGGC AGGATAGGAAAACCGTGCAA Fine mapping 282
ND-5 InDel GCTTTAGCTACGGTTTCCGA TTTGACTCGTCCCAATAGGC Fine mapping 225
ND-11 InDel CCGAGTAGCGAAGCTCAAAT CTAGCATGGACGAACGGATG Fine mapping 103
ND-13 InDel ATTCAGCGTTCCTTAACCCG GACAGAGTCGAGAAACCGTG Fine mapping 116
ND-15 InDel AGATCTCACATGATTATATTCCGA TCTGCAACAAAGTGAAATCCT Fine mapping 117
  1. SSR Simple Sequence Repeat, InDel Insertion/deletion