Skip to main content

Table 2 DNA sequences of qRT-PCR primers for the determination of the level of ethylene and IAA synthesis gene expression in wheat seedlings

From: Mechanisms of the IAA and ACC-deaminase producing strain of Trichoderma longibrachiatum T6 in enhancing wheat seedling tolerance to NaCl stress

Genes Premiers sequence (5′-3′)
TaTGW6 F: CACCTCGTGGTCGCATCT
R: ATCTGGGTAGCCCGGCAG
TaIAGLU F: CGTGTTCGCGCTCAGCCAGT
R: CGAGGGACGCGAAGCTGCCG
TaACO F: CCTACCCGAGGTTCGTGTT
R: CTCCTTGGCCTCGAACTTGT
TaACO1 F: TCCCAGGTTTGGAGTTTCTG
R: ATAGATAGGCGGCTCCCATT
TaACO2 F: CCTACCCGAGGTTCGTGTT
R: CTCCTTGGCCTCGAACTTGT
TaACS F: GATCTCCATGGTCTGGTCGT
R: CTCTTCTCGTGGATGGACCT
TaACS1 F: GAATTCGAT GGTGAGCCAAGT
R: AGCGCGTGGGGGTTCTTCT
TaACS7 F: GAGGTGAAGCTCAACATCTCG
R: TGTTCTTGCTGCGTTGACAT
Actin F: AGCCATACTGTGCCAATC
R: GCAGTGGTGGTGAAGGAGTAA
  1. Note: F represents forward, R represents reverse