Skip to main content

Advertisement

Table 5 Gene and primes sequence details of qPCR

From: Transcriptomic signature reveals mechanism of flower bud distortion in witches’-broom disease of soybean (Glycine max)

Gene Name Gene ID Forward primer Tm Reverse primer Tm
Receptor like kinase isoform X1 RLKI-X1 ACCAAACTCGGAACTTGATGGAGC 63.37 GTAGGCCTAAGTGTTGGAGAAGCA 62.37
Transcript ID: TRINITY_DN54263_c0_g1_i14
La-related protein LRP GGCCCATTCCATTTCCAGCACG 64.61 TGCACATGAGGAAGAAGATGGGGA 63.71
Transcript ID: TRINITY_DN56761_c0_g1_i4
Probable peroxygenase 4 (Glycine max)73,458,878 (putative peroxygenase 4 PPER4 GCTTCCATCATAAACACTTCGG 62.13 AGGAAGGATTGGTGGCTTGGTT 64.61
Transcript ID: TRINITY_DN61766_c0_g1_i1
Zinc finger CCH domain containing protein 69 –like isoform X1 ZF GAGCCTGTCTGAAAGGGGAGCA 64.24 TGCAGCGACTACCATAAGCACA 62.3
Transcript ID: TRINITY_DN56363_c0_g1_i13
AP2 like ethylene responsive transcription factor ANT like AP2TF ACTGTGGGGTGTGGAGAGTTGCA 66.09 GCCCTCTCTTCTTTGCATCCACAGC 66.04
Transcript ID:
TRINITY_DN55029_c2_g4_i10
Glyceraldehyde 3 phosphate dehyadrogenase 2,cytolistic G3PDC GCCCTCTGACTCCTCCTTGATAGCA 65.42 GGCATTCCGTGTCCCTACTGTGGA 66.28
Transcript ID: TRINITY_DN8658_c0_g1_i1
Cellulose synthase A catalytic subunit CS AACTCACCAGACATCGGTTGCCC 65.11 AAGTCGGGGATGCTGTGGGAAGA 65.72
Transcript ID: TRINITY_DN51118_c0_g1_i8
Auxin response Factor 3 ARF3 CCCATTTCATGTGACTCTTCTG 63.63 TGGATTCCAAAGAGCTGAACCT 61.5
Transcript ID: TRINITY_DN22465_c0_g1_i1
Sucrose phosphate Synthase 3 SPS3 AGCCACATTGAGTCCCCAACGG 65.07 TGCGAGGCCTACGTTGTCATCCT 65.98
Transcript ID: TRINITY_DN21034_c0_g1_i1
Ehtylene Respoonsive Trnscription Factor ERF012 ERTF TCAGCAGAAACTCCACAAGCGA 62.43 TGGTATGACTTGGAGGGGTTGCA 63.77
Transcript ID: TRINITY_DN9541_c0_g1_i1