Skip to main content

Table 1 Profiles of the 12 pairs of primers used for the SSR analysis of DP and SP

From: Precocious genotypes and homozygous tendency generated by self-pollination in walnut

Code Locus Repeat motifs Primer sequences (5′–3′) GenBank accession no.
1 WJR022 (AAG)n F: ACGGGACCGGAGTTTACTTT JM057F12
R: CATGGCAGGAGAACTGGTTT
2 WJR033 (TA)n F: AGGGCTCCACTTGATCAGAA JM056N06
R: TCGGCAATCAACCAGATAAA
3 WJR035 (TA)n F: AGTGCATGCCTTGTCTCCTT JM060C06
R: TGCTCCTTGTCAGTCCACAG
4 WJR061 (AT)n F: CAAGACCACAGCACAGCATAA JM008C04
R: GGGAGTGCTGGAATCGAATA
5 WJR087 (TGTC)n F: CCCCCAATATGTCTGCTTCT JM012K14
R: ACCATAGCTGGTTTGGCATC
6 WJR100 (AT)n F: CGACGATTCGGTGAAGAAAT JM031J07
R: GAAAACCCAGTTTCTGTCGG
7 WJR265 (AAT)n F: TGGCTATTGCAAAATCAGGTC JM021P05
R: CAAAAGCATGTAGGTCGGGT
8 WJR294 (CAAAAC)n F: TTTACCTGCCAACACCAACA JM017N12
R: ACAAGGCGAAACAAACTGCT
9 WJR309 (T)n(TTG)n(TTC)n F: TTGCAATAATGCGATGAACG JM006J18
R: TGACTTTGACCATGGCTTTG
10 WGA070 (GA)n F: TGTAATTGGGGAATGTTGCA
R:TGGGAGACACAATGATCGAA
11 WGA079 (GA)n F: CACTGTGGCACTGCTCATCT
R: TTCGAGCTCTGGACCACC
12 WGA089 (TG)n, (GA)n F:ACCCATCTTTCACGTGTGTG
R:TGCCTAATTAGCAATTTCCA