Skip to main content

Table 4 Characterization of outer primers used for nested PCR in wheat

From: “Expression of genes encoding protein disulfide isomerase (PDI) in cultivars and lines of common wheat with different baking quality of flour”

Gene Name Sequence 5′-3′ Product size Annealing temp.
PDI QFnest GAGTATGAGAAGGCGGCCC 983 bp 51 °C
QRnest AGAACATTTTTGCCAGATTTGA
actin AFnest ACAACTGGGATGACATGGGGAA 435 bp 53 °C
ARnest CAAGGGCCACGTAAGCGA
CDC48 CFnest TTAGGCCAGGGCGTCTTGA 542 bp 54 °C
CRnest AGTGAAGGGCACAACAACGAG
\