Skip to main content

Table 3 Characterization of primers used for quantitative analysis for three PDI genes in wheat

From: “Expression of genes encoding protein disulfide isomerase (PDI) in cultivars and lines of common wheat with different baking quality of flour”

Gene Name Sequence 5′-3′ Product size Annealing temp.
PDI-4A QAF CATCCTTACCTCTTGAAATACTTT 194 bp 57 °C
QAR TTCAGGCCAAAGTACTGGAAG
PDI-4B QBF CGGCAAGGATGTCAAGTTCCTA 200 bp 58 °C
QBR TGAATGGTGTCAATTTGCCATCG
PDI-4D QDF CCTCCTGAAATTCTTCCAGAC 186 bp 56 °C
QDR TTCAGCCCGAAGTACTGGAAA
\