Towards reducing the immunogenic potential of wheat flour: omega gliadins encoded by the D genome of hexaploid wheat may also harbor epitopes for the serious food allergy WDEIA

Table 2 PCR primers and amplification conditions used in this study

Target	Primer set	Sequence (5′ - 3′)	Amplicon size	PCR conditions	Reference
GluB3–4 LMW-GS	LB4F	CACCCTATACAAGGTTCCAAAAT	1636	94 °C 60s, 60 °C 60s, 72 °C 60s	[27]
GluB3–4 LMW-GS	LB4R	TATTTCCATAATTTAAACTAGTTTGT	1636	94 °C 60s, 60 °C 60s, 72 °C 60s	[27]
Omega-5 gliadin	O5GF	AGTAGGCTGCTAAGCCCTAGA	1212	94 °C 30s, 60 °C 45s, 72 °C 60s	This study
Omega-5 gliadin	O5GR	ATATTGTTGGTATGGGGAAGG	1212	94 °C 30s, 60 °C 45s, 72 °C 60s	This study
Chromosome 1B Repeat Junction Primers	19S-1.3-2F	CGGGACTCATTGAAGAATCC	418	94 °C 30s, 55 °C 45s, 72 °C 60s	This study
Chromosome 1B Repeat Junction Primers	19S-1.3-2R	ACTAAAGTAGCGATTCAAATCCTC	418	94 °C 30s, 55 °C 45s, 72 °C 60s	This study
Chromosome 1B Repeat Junction Primers	143E-1-600F	CAACGACATATTCTAACCTCCACA	482	94 °C 30s, 60 °C 45s, 72 °C 60s	This study
Chromosome 1B Repeat Junction Primers	143E-1-600R	ACATACATACATCACTGACCGACTG	482	94 °C 30s, 60 °C 45s, 72 °C 60s	This study
Omega-D4	OD4-F1	ACTAGGCAACTAAGCCCTAGA	1037	95 °C 30s, 60 °C 30s, 72 °C 45s	This study
Omega-D4	OD4-R1	GCTTCTTGCGATTGTTGTTGG	1037	95 °C 30s, 60 °C 30s, 72 °C 45s	This study

ISSN: 1471-2229