Skip to main content

Table 1 Single-stranded oligonucleotide (SSON) probes developed in this study

From: High-resolution chromosome painting with repetitive and single-copy oligonucleotides in Arachis species identifies structural rearrangements and genome differentiation

SSON Sequence and 5′- end modification Origin
DP-1 TAMRA-5′-TGCGATCATACCAGCACTAATGCACCGGATCCCGTCAGAACTCTGAAGTTAAGCGTG − 3′ 5S rDNA (GenBank: M10470.1)
DP-2 FAM-5′-ACTACTACTACTACTACTACTACTACTACT-3′ (ACT)10
DP-3 FAM-5′- CATTAAATCAGTTATAGTTTGTTTGATGGTA-3′ Genomic DNA
DP-3 TAMRA −5′- CATTAAATCAGTTATAGTTTGTTTGATGGTA-3′ Genomic DNA
DP-4 TAMRA-5′-ATTATTATTATTATTATTATTATTATTATT-3′ (ATT)10
DP-5 FAM-5′-TTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGG-3′ Telomere repeats
DP-6 TAMRA-5′-AAAAAATCGGAGGAGCCTGCCGAAGATGAGG-3′ Genomic DNA
DP-7 FAM −5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ Genomic DNA
DP-7 TAMRA-5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ Genomic DNA
DP-8 FAM −5′-TGAAAACTTTTTATTTTTAAATTTTGAAACT-3′ Genomic DNA
DP-8 TAMRA-5′-TGAAAACTTTTTATTTTTAAATTTTGAAACT-3′ Genomic DNA