Skip to main content

Table 2 Degree of similarity of individual genome guides to homeologous genes in wheat

From: Efficient generation of stable, heritable gene edits in wheat using CRISPR/Cas9

Vector Genome targeted Genome Target sequence Mismatches (bp)
pRMH110 All genomes gRNA TTGTTTGCCAAGATTTTCCA  
A TTGTTTGCCAAGATTTTCCA n/a
B TTGTTTGCCAAGATTTTCCA n/a
D TTGTTTGCCAAGATTTTCCA n/a
Barley TTGTTTGCCAAGATTTTCCA n/a
pRMH120 and pRMH123 A genome gRNA CTGTGTATGAAGTTGTCCGG  
A CTGTGTATGAAGTTGTCCGG n/a
B CTGCGTATGAAGTTGTCCAG 2
D CTGTGTATGAAGTTGCCCAG 2
pRMH121 B genome gRNA CTGCGTATGAAGTTGTCCAGC  
A CTGTGTATGAAGTTGTCCGGC 2
B CTGCGTATGAAGTTGTCCAGC n/a
D CTGTGTATGAAGTTGCCCAGC 2
pRMH125 D genome gRNA GCCAGGGGAAGTCGAACTAA  
A GCCAAGGGA–––––––––––– 11
B GCCAAGGGA–––––––––––– 11
D GCCAGGGGAAGTCGAACTAA n/a
  1. ‘-‘ absence of nucleotide, bold nucleotide substitution