Skip to main content

Table 4 miRNA regulation of DEGs in DTS and CK samples

From: Comprehensive transcriptome analysis reveals genes in response to water deficit in the leaves of Saccharum narenga (Nees ex Steud.) hack

miRNA sequencea target gene regulationb proteinID description
miR164a TGGAGAAGCAGGGCACGTGCA TRINITY_DN23818_c1_g2 up NAC22_ARATH NAC domain-containing protein 21/22
miR172e-3p GAATCTTTAGACGCATGCAT TRINITY_DN25766_c0_g2 up   
miR6225-5p TAACTAGGCTCAAAAGATTCGTCT TRINITY_DN23398_c1_g2 up NC100_ARATH NAC domain-containing protein 100
miR6284 TTTGGACGCATGCATGGAGCATT TRINITY_DN25766_c0_g2 up NAC22_ARATH NAC domain-containing protein 21/22
miR854a GAGGAGGAAGAGGAGGAGGAG TRINITY_DN23794_c0_g2 up NIP21_MAIZE Aquaporin NIP2–1
miR6220-5p CTCCATCCCAAATTATAAGACGTT TRINITY_DN26349_c2_g1 down TIP42_MAIZE Aquaporin TIP4–2
miR6248 TAATTTGGAATGGAGGGAGTA
miR2671j TTAAAAGATTCGTCTCGTCCA TRINITY_DN28159_c3_g1 down GRF5_ORYSJ Growth-regulating factor 5
miR396e-5p TCCACAGGCTTTCTTGAACTG
miR4993 AGCAGCGGCGGTGGCGGATGC TRINITY_DN22667_c2_g2 up LEA14_GOSHI Late embryogenesis abundant protein Lea14-A
miR5175a TTAGAATTTGGAAAGGAGGGA TRINITY_DN26424_c6_g1 up LEA5_CITSI Late embryogenesis abundant protein Lea5
miR5205b CTTATAATTTGGGATGGAGGGAGT
miR5568f-3p TCTTATAATTTGGAATGGAGG
miR6220-3p AATGACTTATAATTTGGGATGGAG
miR6248 TAATTTGGAATGGAGGGAGTA
miR5568f-3p TCTTATAATTTGGAATGGAGG TRINITY_DN16664_c1_g1 up LEA5D_GOSHI Late embryogenesis abundant protein Lea5-D
miR6248 TAATTTGGAATGGAGGGAGTA
TRINITY_DN17990_c0_g1 up EF114_ARATH Ethylene-responsive transcription factor ERF114
miR854a GAGGAGGAAGAGGAGGAGGAG TRINITY_DN20050_c2_g1 up
TRINITY_DN24075_c2_g3 up ERF53_ARATH Ethylene-responsive transcription factor ERF053
miR4993 AGCAGCGGCGGTGGCGGATGC TRINITY_DN22160_c1_g2 up ERF60_ARATH Ethylene-responsive transcription factor ERF060
miR1023a-3p CAAGAATTGGATGAAGTGCAT TRINITY_DN22589_c0_g1 down R13L3_ARATH Putative disease resistance RPP13-like protein 3
miR3522 AGCCCAAGTCGAGACAGCTGA TRINITY_DN20821_c1_g2 down
miR6220-5p CTCCATCCCAAATTATAAGACGTT TRINITY_DN17917_c0_g2 down RGA1_SOLBU Putative disease resistance protein RGA1
miR8014-3p ATTAATCAATGTTTGGACAATT TRINITY_DN20066_c3_g1 down RGA3_SOLBU Putative disease resistance protein RGA3
miR854a GAGGAGGAAGAGGAGGAGGAG TRINITY_DN22688_c0_g1 down
TRINITY_DN25829_c1_g3 up
miR6220-5p CTCCATCCCAAATTATAAGACGTT TRINITY_DN25593_c2_g1 up RGA4_SOLBU Putative disease resistance protein RGA4
miR5205b CTTATAATTTGGGATGGAGGGAGT TRINITY_DN24732_c1_g1 down RK12_ORYSJ 50S ribosomal protein L12, chloroplastic
miR5568f-3p TCTTATAATTTGGAATGGAGG
miR6248 TAATTTGGAATGGAGGGAGTA
miR854a GAGGAGGAAGAGGAGGAGGAG TRINITY_DN18780_c1_g2 down RK28_ARATH 50S ribosomal protein L28, chloroplastic
TRINITY_DN25639_c1_g1 down WRK19_ARATH Probable WRKY transcription factor 19
TRINITY_DN23859_c0_g1 up WRK40_ARATH Probable WRKY transcription factor 40
miR172e-3p GAATCTTTAGACGCATGCAT TRINITY_DN19490_c0_g1 up WRK54_ARATH Probable WRKY transcription factor 54
miR6284 TTTGGACGCATGCATGGAGCATT
miR1436 ACTTTCAATGGGACGGAGGGAGT TRINITY_DN22501_c1_g1 up WRK57_ARATH Probable WRKY transcription factor 57
miR4993 AGCAGCGGCGGTGGCGGATGC
miR5205b CTTATAATTTGGGATGGAGGGAGT
miR6220-3p AATGACTTATAATTTGGGATGGAG
miR5139 AACCTGGCTCCGATACCA TRINITY_DN18434_c1_g4 up 5NG4_PINTA Auxin-induced protein 5NG4
  1. amiRNA sequence
  2. bup−/down-regulation of the gene in DTS compared to CK samples