Skip to main content
Fig. 3 | BMC Plant Biology

Fig. 3

From: The rare orange-red colored Euphorbia pulcherrima cultivar ‘Harvest Orange’ shows a nonsense mutation in a flavonoid 3’-hydroxylase allele expressed in the bracts

Fig. 3

Multiple alignment of a selected part of the nucleotide sequences at the 5′-terminus of F3′H cDNA clones of Euphorbia pulcherrima cvs. ‘Harvest Orange’ (EpHO_F3′H, KY273441), ‘Premium Red’ (EpPR_F3′H, KY489667), ‘Christmas Beauty’ (EpCB_F3′H, KY273439), and ‘Christmas Feeling’ (EpCF_F3′H, KY273440). The grey-shaded frame highlights the repetition of ACCATTTTTTCTGCCATTTT from position 22 to 41 in position 50 to 69 (numbering from EpHO_F3′H)

Back to article page

BMC Plant Biology

ISSN: 1471-2229

Contact us