Skip to main content

Table 2 Primers used in this study

From: Molecular mechanism of seed dormancy release induced by fluridone compared with cod stratification in Notopterygium incisum

Gene name Unigene Length of unigene (bp) Primer
CCD8 c115090_g1 1836 5’ATTCATTCGGCTCATCCTAT5’TGTCCCTGGCTCCATTCTCA
D27 c124833_g3 3392 5’TTCATTCTTCTCCTCCTCTA5’GACGGTTTGCTACTTCTATT
C4H c89387_g1 1840 5’TTGAGGCTAATGGAAATGAT5’CCAACCGTCCAATAGTGATA
4CL2 c114521_g1 2168 5’TGATCCTGATACGTCCATCT5’GCCAGCCTTCTTTGTCTATT
PAL3 c121330_g2 2578 5’GGATTATGGATTCAAGGGTG5’CTACTTGGCTTACGGTGTTT
CYP707A1 c119998_g1 1934 5’ATCGGAGAAACCTTCCAACT5’TAACACAAGGACATCCCAAT
ABI3 c125897_g1 4448 5’GTTGGGTGCTTCTGCTACTA5’TTTCTACACTAAACTTCCCT
ABI5 c126875_g2 1824 5’GCAGCCACAGTCACCACAGC5’CCCTTATCAGAAAGTCCTCG
ABF3 c125091_g2 3521 5’GTTACCTCGGACACTTAGCC5’TCACTCAAAGTTGCTTCCCT
GA2OX1 c101392_g1 1457 5’TGGTGAAACCCCAGAAAACT5’GGAACTGAAATCCAAGAGCC
GA20OX1 c64760_g1 1656 5’GGCGGTCTATTCGTCCTAAC5’TGGGCTCACCATCTTATCTT
GID1B c104456_g1 2086 5’ACTTCTTCATCCATTCTTTG5’CTGGGTGGTCTCTATCTTCA
GASA14 c83558_g1 809 5’ACTGTGCCAAGTGAGGTGCG5’TGGGTGGTCATGTCGGTGTA
GASA6 c92944_g1 778 5’CACTTGGACAGGAACGGAAA5’TAGAAACCAGGGGGAACACA
LUT5 c123510_g1 3269 5’GGAGTCACTCTTTTCCCGTT5’CTATCTTCCGCTTCTCGCAG
PDS c109548_g1 3109 5’CTCAATGGAGGGTGCTGT5’GGATTTATTTGGGTCGTA
VDE c95526_g1 2509 5’GACAACTCGTGCATTTATTC5’TCCTTATCTACATTTATCCC
GAPDH2 c111413_g1 1948 5’CCGCCACCAGGTCTCATCTC5’GGGAACGGAAGCACCAAAGA
PAL1 c121330_g1 1560 5’CACATAAGTTGAAGCACCAC5’TTGACAGAATTGATCTCCCT
4CLL5 c112506_g1 1482 5’CAACTCACGGAAACCTAATC5’CAACTATCGGTGGCACTAAA
FAOMT c116578_g2 1020 5’AAAGGAAGGGAGCATGAGTT5’CAAGGGCAGTAGTTAGGAGA
C3H c107316_g2 2056 5’AGGAGCTTGACCGCGTAATC5’TGTGAGGGAGCATCATAGGG
CYP75B2 c109322_g1 2033 5’AGCCCTTACCCACTTCCACC5’ACCACCACATGAACCAACCC
FNSI c102684_g1 1533 5’AGACCCGAGATATGCCGTAA5’TCGTCACCCTGAAGATGAGT
PYL5 c73037_g1 1771 5’AACAAATAGACGCCCCACTC5’TAACGCTAAAGCTCATCACA
CYP711A1 c125007_g2 4428 5’TTTACGCTATCCACAATCAT5’CTAACACTCCAAGAGCCAAC
DAD2 c111513_g1 1435 5’GTGTCCGTACCAGCATCAGT5’GCTCGTTAGCCAACAATCCC
MAX2 c48123_g1 2398 5’GGAATGTGGCTGACCTAACG5’AATCAATGTGAAGTCGCAAG
GA20OX5 c86483_g1 1756 5’AAAGCTGCACATGATGAAAT5’TCCGCATGAGCACCAGAGTA
GA3OX1 c79821_g1 2012 5’CGACTTGAATGACCCGATTA5’AGCTTCCTTGCAGCAACCTC
GA2OX2 c95152_g1 1338 5’TCAATAACGGTAGTGCTCCT5’TTGTCAAAGCCTGAAATGTG
GA2OX8 c113148_g1 1704 5’TTATCAACGGGCTTTCTACG5’AAACTGAAGGCCACCAACTA
GAI c98921_g1 2363 5’GTTGAGCGACACGAGACATT5’CGAGTTGCCAAGCAGAGGTA
GID1C c37750_g1 2004 5’CCAACGAGCCTACTTACCCG5’GTCCCGACTTTGAAGCCATG
RNA replication protein c126998_g1 6214 5’GCCCACGGGTGAACTAATCT5’GTTGAGTGACATAGGCGAGA