Skip to main content

Table 2 Sequences of forward and reverse primers for amplification of apple genes used in the Bisulfite sequencing-PCR analyses

From: The effect of promoter methylation on MdMYB1 expression determines the level of anthocyanin accumulation in skins of two non-red apple cultivars

Primer position Sense Primer (5′-3′) Anti-sense Primer (5′-3′)
−2026, − 1870a GAAATYGTTYGAAGGTYTAAGG ACARCAAACACCCAAAATCC
−1898, −1633 TGATTAAAGGGATTTTGGGTGTTTG AAATARAACCRRACCTATCTCA
−1667, −1287 GTTTGTAAYAGAYTGAGATAGGT TCCAAAACCCCARATTCTTAT
−1312, −1035 TATGYATAAGAATYTGGGGTTTTGGA CTTACTTRRTCACATTATACCATC
−1062, −964 YAYYGATGGTATAATGTGAYYAAGT ACATTATTTTCATARRTRRTTCARCC
−989, −774a GGYTGAAYYAYYTATGAAAATAATG ARACRCTACACCTAACACATTRCT
−841, −533 TTGTGAAAGYTTAGTGAGTTGAAG ATTCTCTCCTTTTTTTCCCTCTTCT
−541,-435 GGAGAGAATYYTAYTYYATAAATTAYAAG CTTTCRCTRCTTTTTCAARTRTT
−434, −188 TTATGGTGGTYAAAGATGTGTGTTGTAA CAAACACTRACAARTTTAAAACATTCCAACA
−198, −60 GTYAGTGTTTGYTTYTGTGGATATY TCCARAAARACACCTARCTACC
−51, 106a AGTGGGTAGYAGGYAAAAGA TCCACTTTCCCTCTCCATRA
  1. aPrimers modified from Telias et al. [11]. Y = C or T; and R = A or G