Skip to main content

Table 1 DNA sequences of oligonucleotide primers used in real-time PCR and MdMYB1 genomic sequence analyses

From: The effect of promoter methylation on MdMYB1 expression determines the level of anthocyanin accumulation in skins of two non-red apple cultivars

Gene identifier (Genbank) Gene Name Sense Primer (5′-3′) Anti-sense Primer (5′-3′)
AB074485.1 MdCHS AGTGACACCCACCTTGATAG CTGTCGGGGAGAATGGTTTG
AF494398.1 MdCHI GTTACAGGTCCGTTTGAGAA AACTTTTCAATGGCTTTGCCTTCTG
AB074486.1 MdF3H CTGCTACTACGCTGACATCC AATACCCCAGTCCTCACAAG
AF117268.1 MdDFR ATTTATCTTTACGAGCATCC CCCTATCTCCCTCAACTTCT
AB074487.1 MdANS GTTCCAAATTCCATCGTCAT TCACCTTTTCCTTGTTCACC
AF117267.1 MdUFGT TCGTAGCCTTCCCTTTCACT TTATCAATGCTGTTGTTGGAAAAGA
DQ886414.1 MdMYB1 GTCGTCGTCAACAAAGAATGG GGTCCGTGCTAAAGGAGAAT
HM122458.1 MdbHLH3 GTAAAGAGTTGCGAAGTGGG GTAAAGGTTCTGGCTGAGGT
GU173813.1 MdTTG1 AGAGCGGAGAACTCGGTGAC CGATTCGGTGGTGCTGGTG
GQ339778.1 MdACTIN CTGAACCCAAAGGCTAATCG ACTGGCGTAGAGGGAAAGAA
DQ886414.1/DQ886415.1 PMBY1 AACAGTATCAGTTCGTGCATCAGTG CTCAACGCACTGCCTGAGAAGATTG
DQ886414.1/DQ886415.1 PMBY2 TGAGTGTGAGAAAAGGTGCCTGGAC CACAATCTTAAAGGTTTGCTCAGTCGA
DQ886414.1/DQ886415.1 PMBY3 GGATTCAAATAAAGTATCAAACAGG CAAGCAAGGAAAATAATAGAACACA