Skip to main content

Table 1 Primer sequences used for PCR and qPCR

From: Transcript profiling of sucrose synthase genes involved in sucrose metabolism among four carrot (Daucus carota L.) cultivars reveals distinct patterns

Gene ORF (bp) PCR qPCR
Forward primer (5′-3′) Reverse primer (5′-3′) Forward primer (5′-3′) Reverse primer (5′-3′)
DcSus1 2427 CGTTTCATTCGTCCCCTCCGTTCA CCAGCCCAATGCCTCTTCTTCTC GGCTCCACAACTACAATGGCAAGA CAGTAACACGCTCCGCAGTATCAC
DcSus2 2454 GAGTGACAGCGAAAGAAGAAGAA CTCCCATCATATTTGAACAATCCAG CCTGTATAGAGTTGTCCACGGCATAGA TGCTCCTCATTCTGCTCTGGATCATAT
DcSus3 2628 GGCATTTTATTCTATACGCCCTTA CAGCTTTGGTTGTCTTCATCCTC TACTTCTTGACATCCTTCAGGCTCCT AGGCAGACCTAATACATTCGCTTGG
DcActin     CGGTATTGTGTTGGACTCTGGTGAT CAGCAAGGTCAAGACGGAGTATGG
DcEF-1α     TCAAGGATCTCAAGCGTGGTTATGT CAGCAATGTGGCAAGTGTGACAAT