Skip to main content

Table 2 Novel miRNAs identified small RNA population of C. borivilianum

From: Small RNA profiling for identification of miRNAs involved in regulation of saponins biosynthesis in Chlorophytum borivilianum

miRNA Novel Mature Sequence Length Read Count AU(%) Strand MFE for Precursor
Precursor
cbo-miR1 AAUGACUUGCGGACGUCUAGACGU 24 4268 48.7 + −34.14
cbo-miR2 AUCCGCAUCCGAAUCCGAAUCCGC 24 28 49.3 + −29.15
cbo-miR3 GCGGUGACGGAUCUGCUUUUC 21 23,252 40.7 −34.14
cbo-miR4 AAAAGCGGAUUCGGAUUCGGAUGC 24 469 53.1 −34.14
cbo-miR5 CGACUCCGUCGACCUUUUCUGA 22 5194 43.2 −29.15