Skip to main content

Advertisement

Table 2 Primers used for qRT-PCR

From: Transcriptomic analysis of wound xylem formation in Pinus canariensis

Contig name Oligo name Description   bp Tm GC% Sequence (5’-3’)
Contig00654 Pc_00654_CESA_F1 cellulose synthase a-like protein Forward 20 63.0 55 GGACCACACTCCTCATTCCT
Pc_00654_CESA_R1 Reverse 20 63.0 45 ACCCCATGACTGAAATCCAT
Contig12050 Pc_12050_MYB_F1 MYB46-like protein Forward 20 62.8 45 ATTCCCAACATGGAAGAAGC
Pc_12050_MYB_R1 Reverse 20 63.7 50 CTGCATCACCATCACACTCA
Contig20304 Pc_20304_ATHB13_F1 ATHB13-like protein Forward 20 63.2 50 CCCATTCTCATGATGTCTGC
Pc_20304_ATHB13_R1 Reverse 20 63.1 50 CAGAACTGCCTTCACTTCCA
Contig00787 Pc_00787_NAC_F1 NAC2-like prtoein Forward 20 62.5 45 CTAAATGGCCCTGGGTAAAA
Pc_00787_NAC_R1 Reverse 20 62.8 50 CCCCTTCTTCTTACCAACCA
Contig20555 Pc_20555_PAL_F1 phenylalanine ammonia-lyase-like protein Forward 20 63.1 50 GAATTGACGTCCTGGTTGTG
Pc_20555_PAL_R1 Reverse 20 62.7 50 CAGCCTGGACTATGGTTTCA
Contig03225 Pc_03225_EXPANSIN_F1 α-expansin-like protein Forward 20 62.8 45 AAGCGGAGCTGATTCTTGAT
Pc_03225_EXPANSIN_R1 Reverse 20 63.1 60 CTCAGAGCCACAGAGACGAG
Contig05551 Pc_05551_WRKY_F1 WRKY51-like protein Forward 20 62.5 45 ACGCAGAGGGGAATAAGAAA
Pc_05551_WRKY_R1 Reverse 20 63.2 50 CAGAAAACGTTCACCCACAG
Contig06476 Pc_06476_CCoAOMT_F1 CCoAOMT-like protein Forward 20 64.0 50 GATTGAACAACCGAGGTGCT
Pc_06476_CCoAOMT_R1 Reverse 20 63.6 45 TGCAACACCTGAATTCCAAC
Contig06813 Pc_06813_WOX_F1 WOX4-like protein Forward 20 63.1 50 TCTCGGCTCATGTTCACTTC
Pc_06813_WOX_R1 Reverse 20 63.1 50 TACCAGTGGTTGCAGGTGTT
Contig09007 Pc_09007_EXO_F1 exordium 2-like protein Forward 20 62.9 45 TACCCGATCATGCAAGACAT
Pc_09007_EXO_R1 Reverse 20 62.7 55 GCGCCTAAATCTACCTGCTC
Contig05923 Pc_05923_bHLH_F1 bHLH35-like protein Forward 20 63.9 45 GTGCGAATAGAGGGCAAAAA
Pc_05923_bHLH_R1 Reverse 20 64.1 45 CGAAGCAGCAGATGTTTGAA
Contig22185 Pc_22185_PR_F1 Major allergen PRU-like protein Forward 20 65.0 60 GTGGAGGCAAGGAGACTGTG
Pc_22185_PR_R1 Reverse 19 64.9 63.2 CTGCCTACGCCTCCATCTC
House-keeping Ri18S_FW 18S ribosomal Forward 19 62.4 53 GCGAAAGCATTTGCCAAGG
Ri18S_RV Reverse 21 62.4 48 ATTCCTGGTCGGCATCGTTTA
  1. Tm: Melting temperature. GC%: guanine-cytosine content